Hereditary Melanoma and Skin Cancer Panel

PLUSbpg-method SEQbpg-method DEL/DUPbpg-method

Test code: ON0501

The Blueprint Genetics Hereditary Melanoma and Skin Cancer Panel analyzes 19 genes associated with inherited susceptibility to melanoma and skin cancer.

Skin cancer is one of the most common types of cancer. Some inherited conditions increase the risk of skin cancer and subset of the disease has familial origins. For example, 8% of individuals with melanoma have first-degree relatives with the same disease. Inhritance pattern is autosomal dominant with exception of xeroderma pigmentosum that is inherited in an autosomal recessive manner. The Hereditary Melanoma and Skin Cancer Panel is suited for detecting heritable germline mutations and may not be used for the detection of somatic mutations in tumor tissue. This Panel is part of the Comprehensive Hereditary Cancer Panel.

About Hereditary Melanoma and Skin Cancer

Cancers arising in the skin include basal-cell cancer, squamous cell cancer, and melanoma. Melanomas may rarely also occur in the mouth, intestines, or eye. Ultraviolet radiation from exposure to sun light or tanning beds is the main cause for skin cancer. A subset of skin cancers is associated with various hereditary cancer syndromes. Familial atypical multiple mole melanoma syndrome is caused by mutations in the CDKN2A gene that may be present in up to 40% of the familial cases of melanoma. Familial melanoma, caused by pathogenic mutations in the CDK4 gene, also increases the risk for melanoma. Gorlin syndrome is associated with pathogenic mutations in the PTCH1 and SUFU genes and increases the risk of developing basal cell carcinomas. Other cancer susceptibility syndromes/genes that increase the risk of developing skin cancers, either as a primary or secondary disease, include BAP1-related tumor predisposition syndrome (BAP1), hereditary breast and ovarian cancer syndrome (BRCA1 and BRCA2), retinoblastoma (RB1), xeroderma pigmentosum (several genes), MITF-related melanoma and renal cell carcinoma predisposition syndrome (MITF), Li-Fraumeni syndrome (TP53), Cowden syndrome (PTEN), and Werner syndrome (WRN).

Availability

Results in 3-4 weeks. We do not offer a maternal cell contamination (MCC) test at the moment. We offer prenatal testing only for cases where the maternal cell contamination studies (MCC) are done by a local genetic laboratory. Read more: http://blueprintgenetics.com/faqs/#prenatal

Genes in the Hereditary Melanoma and Skin Cancer Panel and their clinical significance
Gene Associated phenotypes Inheritance ClinVar HGMD
BAP1 Tumor predisposition syndrome AD 13 73
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2207 2054
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 2514 1791
CDK4 Melanoma, cutaneous malignant AD 2 11
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 37 217
DDB2 Xeroderma pigmentosum AR 4 15
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 18 90
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 9 16
ERCC4 Fanconi anemia, Xeroderma pigmentosum AR 11 37
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 17 51
MITF Renal cell carcinoma with or without malignant melanoma, Tietz albinism-deafness syndrome, Waardenburg syndrome, Melanoma, cutaneous malignant AD 15 50
PTCH1 Basal cell nevus syndrome AD 46 348
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 192 564
RB1 Retinoblastoma AD 111 1013
SUFU Medulloblastoma, Basal cell nevus syndrome AD 7 27
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 148 391
WRN* Werner syndrome AR 20 97
XPA Xeroderma pigmentosum AR 10 47
XPC Xeroderma pigmentosum AR 15 91

*Some regions of the gene are duplicated in the genome leading to limited sensitivity within the regions. Thus, low-quality variants are filtered out from the duplicated regions and only high-quality variants confirmed by other methods are reported out. Read more.

Gene, refers to HGNC approved gene symbol; Inheritance to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR) and X-linked (XL); ClinVar, refers to a number of variants in the gene classified as pathogenic or likely pathogenic in ClinVar (http://www.ncbi.nlm.nih.gov/clinvar/); HGMD, refers to a number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD, http://www.hgmd.cf.ac.uk/ac/). The list of associated (gene specific) phenotypes are generated from CDG (http://research.nhgri.nih.gov/CGD/) or Orphanet (http://www.orpha.net/) databases.

Gene Genomic location HG19 HGVS RefSeq RS-number Comment Reference
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
CDKN2A Chr9:21974860 c.-34G>T NM_000077.4 rs1800586
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
RB1 Chr13:48877860 c.-189G>T NM_000321.2 rs387906520
RB1 Chr13:48877851 c.-198G>A NM_000321.2 rs387906521
RB1 Chr13:49046098 c.2490-1398A>G NM_000321.2
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

Blueprint Genetics offers a comprehensive Hereditary Melanoma and Skin Cancer Panel that covers classical genes associated with BAP1-related tumor predisposition syndrome, basal cell nevus syndrome, Cowden syndrome, familial atypical multiple mole melanoma syndrome, familial melanoma, Gorlin syndrome, hereditary breast and ovarian cancer syndrome, Li-Fraumeni syndrome 1, MITF-related melanoma and renal cell carcinoma predisposition syndrome, melanoma, retinoblastoma, skin cancer, Werner syndrome and xeroderma pigmentosum complementation. The genes are carefully selected based on the existing scientific evidence, our experience and most current mutation databases. Candidate genes are excluded from this first-line diagnostic test. The test does not recognise balanced translocations or complex inversions, and it may not detect low-level mosaicism. The test should not be used for analysis of sequence repeats or for diagnosis of disorders caused by mutations in the mitochondrial DNA.

Analytical validation is a continuous process at Blueprint Genetics. Our mission is to improve the quality of the sequencing process and each modification is followed by our standardized validation process. Average sensitivity and specificity in Blueprint NGS Panels is 99.3% and 99.9% for detecting SNPs. Sensitivity to for indels vary depending on the size of the alteration: 1-10bps (96.0%), 11-20 bps (88.4%) and 21-30 bps (66.7%). The longest detected indel was 46 bps by sequence analysis. Detection limit for Del/Dup (CNV) analysis varies through the genome depending on exon size, sequencing coverage and sequence content. The sensitivity is 71.5% for single exon deletions and duplications and 99% for three exons’ deletions and duplications. We have validated the assays for different starting materials including EDTA-blood, isolated DNA (no FFPE) and saliva that all provide high-quality results. The diagnostic yield varies substantially depending on the used assay, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be cost-effective first line test if your patient’s phenotype is suggestive for a specific mutation profile.

The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. The highest relevance in the reported variants is achieved through elimination of false positive findings based on variability data for thousands of publicly available human reference sequences and validation against our in-house curated mutation database as well as the most current and relevant human mutation databases. Reference databases currently used are the 1000 Genomes Project (http://www.1000genomes.org), the NHLBI GO Exome Sequencing Project (ESP; http://evs.gs.washington.edu/EVS), the Exome Aggregation Consortium (ExAC; http://exac.broadinstitute.org), ClinVar database of genotype-phenotype associations (http://www.ncbi.nlm.nih.gov/clinvar) and the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk). The consequence of variants in coding and splice regions are estimated using the following in silico variant prediction tools: SIFT (http://sift.jcvi.org), Polyphen (http://genetics.bwh.harvard.edu/pph2/), and Mutation Taster (http://www.mutationtaster.org).

Through our online ordering and statement reporting system, Nucleus, the customer can access specific details of the analysis of the patient. This includes coverage and quality specifications and other relevant information on the analysis. This represents our mission to build fully transparent diagnostics where the customer gains easy access to crucial details of the analysis process.

In addition to our cutting-edge patented sequencing technology and proprietary bioinformatics pipeline, we also provide the customers with the best-informed clinical report on the market. Clinical interpretation requires fundamental clinical and genetic understanding. At Blueprint Genetics our geneticists and clinicians, who together evaluate the results from the sequence analysis pipeline in the context of phenotype information provided in the requisition form, prepare the clinical statement. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals, even without training in genetics.

Variants reported in the statement are always classified using the Blueprint Genetics Variant Classification Scheme modified from the ACMG guidelines (Richards et al. 2015), which has been developed by evaluating existing literature, databases and with thousands of clinical cases analyzed in our laboratory. Variant classification forms the corner stone of clinical interpretation and following patient management decisions. Our statement also includes allele frequencies in reference populations and in silico predictions. We also provide PubMed IDs to the articles or submission numbers to public databases that have been used in the interpretation of the detected variants. In our conclusion, we summarize all the existing information and provide our rationale for the classification of the variant.

A final component of the analysis is the Sanger confirmation of the variants classified as likely pathogenic or pathogenic. This does not only bring confidence to the results obtained by our NGS solution but establishes the mutation specific test for family members. Sanger sequencing is also used occasionally with other variants reported in the statement. In the case of variant of uncertain significance (VUS) we do not recommend risk stratification based on the genetic finding. Furthermore, in the case VUS we do not recommend use of genetic information in patient management or genetic counseling. For some cases Blueprint Genetics offers a special free of charge service to investigate the role of identified VUS.

We constantly follow genetic literature adapting new relevant information and findings to our diagnostics. Relevant novel discoveries can be rapidly translated and adopted into our diagnostics without delay. These processes ensure that our diagnostic panels and clinical statements remain the most up-to-date on the market.

Find more info in Support

Like this:

Download PDF

Choose an analysis method

$ $ 1400
$ $ 1000
$ $ 1600
Total $
Order now

ICD & CPT codes

CPT codes

SEQ 81479
DEL/DUP 81479


ICD codes

Commonly used ICD-10 codes when ordering the Hereditary Melanoma and Skin Cancer Panel

ICD-10 Disease
C43.9 Melanoma
Z12.83 Skin cancer

Accepted sample types

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 5μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Subscribe to our newsletter