Comprehensive Hematology and Hereditary Cancer Panel

Summary
Is a 369 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of hematological disorder with genetic predisposition to malignancies.

This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.

Is not recommended for patients suspected to have anemia due to alpha-thalassemia (HBA1 or HBA2). These genes are highly homologous reducing mutation detection rate due to challenges in variant call and difficult to detect mutation profile (deletions and gene-fusions within the homologous genes tandem in the human genome).

Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
369
Test code
HE1401
Panel tier
Tier 4
CPT Code *
81162, 81218, 81238, 81249, 81351, 81317, 81319, 81307, 81298, 81300, 81292, 81294, 81363, 81364, 81259, 81269, 81406 x2, 81404 x5, 81405 x4, 81406 x11, 81407, 81408 x3, 81479, see below **
See below **
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.
** CPT coding is dependent on patient history and payer being billed.

Summary

The Blueprint Genetics Comprehensive Hematology and Hereditary Cancer Panel (test code HE1401):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in *PTEN*.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Inherited hematological diseases are a group of blood disorders with variable clinical presentation. Many of them predispose to malignancies and for example patients with inherited bone marrow failure syndromes (Fanconi anemia) have a high risk of developing cancer, either leukemia or solid tumors. Genetic testing is the most effective way to identify individuals with inherited hematological diseases and a genetic predisposition to develop malignancies. Accurate genetic diagnosis enables personal cancer risk assessment and inherited genetic variant can be taken into account when planning the treatment and the follow-up of both unaffected and affected persons. In most of the cases, cancer mortality can be significantly reduced in high-risk individuals by regular surveillance and preventive strategies.

Genes in the Comprehensive Hematology and Hereditary Cancer Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ABCA3 Rajab interstitial lung disease with brain calcifications 2, Surfactant metabolism dysfunction, pulmonary AR 11 287
ABCB7 Anemia, sideroblastic, and spinocerebellar ataxia XL 8 9
ABCG5 Sitosterolemia AR 13 42
ABCG8 Sitosterolemia AR 18 44
ACD Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 AD/AR 2 8
ACTB* Baraitser-Winter syndrome AD 55 60
ACTN1 Bleeding disorder, platelet-type 15 AD 7 25
ADAMTS13 Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, familial AR 30 183
AIP Pituitary adenoma, familial isolated AD 53 110
AK1 Adenylate kinase deficiency, hemolytic anemia due to AR 8 10
AK2 Reticular dysgenesis AR 14 17
ALAS2 Anemia, sideroblastic, Protoporphyria, erythropoietic XL 27 103
ALK Neuroblastoma AD 31 15
AMN Megaloblastic anemia-1, Norwegian AR 29 34
ANK1 Spherocytosis AD/AR 20 105
ANKRD26 Thrombocytopenia AD 6 21
AP3B1 Hermansky-Pudlak syndrome AR 14 34
AP3D1 Hermansky-Pudlak syndrome 10 AR 1 4
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 773 1926
ARPC1B Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease AR 2 4
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATR Cutaneous telangiectasia and cancer syndrome, Seckel syndrome AD/AR 10 33
ATRX Carpenter-Waziri syndrome, Alpha-thalassemia/mental retardation syndrome, Holmes-Gang syndrome, Juberg-Marsidi syndrome, Smith-Fineman-Myers syndrome, Mental retardation-hypotonic facies syndrome XL 65 165
AXIN2 Oligodontia-colorectal cancer syndrome, Oligondontia, isolated AD 19 18
BAP1 Tumor predisposition syndrome, Neurodevelopmental disorder AD 74 113
BARD1 Breast cancer AD 159 114
BLM Bloom syndrome AR 152 119
BLOC1S3 Hermansky-Pudlak syndrome AR 2 4
BLOC1S6 Hermansky-Pudlak syndrome AR 1 2
BMPR1A* Polyposis, juvenile intestinal AD 110 140
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 134 65
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial, Fanconi anemia AD 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Breast cancer AD/AR 238 189
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 14 28
C15ORF41 Congenital dyserythropoietic anemia AR 3 3
C6ORF25 AR 1 1
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 24 43
CD59 CD59 deficiency AR 4 8
CD70 Primary immunodeficiency AR 4
CDAN1 Anemia, dyserythropoietic congenital AR 12 61
CDC42* Takenouchi-Kosaki syndrome, Noonan-syndrome like phenotype AD 11 9
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 50 101
CDH1 CDH1-related cancer, Blepharocheilodontic syndrome 1 AD 178 242
CDK4 Melanoma, cutaneous malignant AD 4 14
CDKN1B Multiple endocrine neoplasia AD 13 20
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CECR1 Polyarteritis nodosa, ADA2 deficiency AR 15 50
CEP57 Mosaic variegated aneuploidy syndrome AR 5 5
CHEK2* Breast cancer, susceptibility to AD/AR 275 197
CLCN7 Osteopetrosis AD/AR 15 98
CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) AD/AR 26 25
CSF2RA#* Surfactant metabolism dysfunction, pulmonary XL 2 17
CSF3R Neutrophilia, hereditary AD/AR 13 13
CTC1 Cerebroretinal microangiopathy with calcifications and cysts AR 21 33
CTLA4 Autoimmune lymphoproliferative syndrome, type V AD 11 34
CTNNA1 Macular dystrophy, patterned 2 AD 6 10
CTSC Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome AR 19 92
CUBN* Megaloblastic anemia-1, Finnish AR 42 53
CXCR4 Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome AD 5 15
CYB5R3 Methemoglobinemia due to methemoglobin reductase deficiency AR 21 71
CYCS* Thrombocytopenia AD 2 3
CYLD Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis AD 34 106
DDB2 Xeroderma pigmentosum AR 4 17
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 9 21
DHFR* Megaloblastic anemia due to dihydrofolate reductase deficiency AR 2 5
DICER1* DICER1 syndrome AD 197 137
DIS3L2* Perlman syndrome AR 12 14
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNASE2 Autoinflammatory-pancytopenia syndrome AR 2
DTNBP1 Hermansky-Pudlak syndrome AR 2 3
EFL1* Shwachman-Diamond syndrome 3 2
EGFR Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial AD/AR 55 18
EGLN1* Hemoglobin, high altitude adapation AD 3 64
ELANE Neutropenia AD 43 217
EPAS1 Erthyrocytosis, familial 4 AD 3 30
EPB41 Ellipsocytosis 1 AD/AR 6 12
EPB42 Spherocytosis AR 8 17
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
EPOR Erythrocytosis, familial, 1 AD 4 32
ERCC1 Cerebrooculofacioskeletal syndrome 4 AR 8 5
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 AR 26 98
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 10 19
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 13 70
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 21 54
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
ETV6 Thrombocytopenia 5 AD 10 38
EXO1 Lynch syndrome AD/AR 1 14
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
EXT2 Multiple cartilagenious exostoses 2, Seizures, scoliosis, and macrocephaly syndrome AD/AR 45 250
EZH2 Weaver syndrome AD 29 41
F10 Factor X deficiency AR 15 155
F11 Factor XI deficiency AD/AR 77 271
F12 Angioedema, Factor XII deficiency AD/AR 7 53
F13A1 Factor XIIIA deficiency AR 20 180
F13B Factor XIIIB deficiency AR 4 18
F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, congenital AD/AR 14 66
F5 Factor V deficiency, Thrombophilia due to activated protein C resistance AD/AR 19 157
F7 Factor VII deficiency AR 27 322
F8* Hemophilia A XL 296 3205
F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX defect XL 117 1281
FADD Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations AR 2 1
FAM111B* Hereditary Fibrosing Poikiloderma with Tendon Contracture, Myopathy, and Pulmonary Fibrosis, Lung cancer, familial, susceptibilty to AD 7 7
FANCA Fanconi anemia AR 191 677
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FANCD2* Fanconi anemia AR 21 61
FANCE Fanconi anemia AR 4 17
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 16 92
FANCI Fanconi anemia AR 13 45
FANCL Fanconi anemia AR 13 24
FANCM Fanconi anemia AD/AR 6 50
FAS Autoimmune lymphoproliferative syndrome AD/AR 31 133
FASLG Autoimmune lymphoproliferative syndrome, type IB AD/AR 2 10
FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis AD/AR 10 144
FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital AD/AR 6 92
FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital AD/AR 7 127
FH Hereditary leiomyomatosis and renal cell cancer, Fumarase deficiency AD/AR 178 207
FLCN Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous AD 154 210
FLI1 Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet type 21 AD 7 7
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects, Periventricular nodular heterotopia 1, Melnick-Needles syndrome, Intestinal pseudoobstruction, neuronal, X-linked/Congenital short bowel syndrome, Cardiac valvular dysplasia, X-linked XL 133 257
FYB Thrombocytopenia 3 AR 2 2
G6PC3 Neutropenia, severe congenital, Dursun syndrome AR 11 37
G6PD Glucose-6-phosphate dehydrogenase deficiency XL 45 226
GALNT12 Colorectal cancer, susceptibility to, 1, Inflammatory bowel disease AD 8
GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia XL 21 15
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GBA* Gaucher disease AR 84 488
GCLC Gamma-glutamylcysteine synthetase deficiency AR 2 7
GFI1 Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults AD 2 6
GFI1B Bleeding disorder, platelet-type, 17 AD 6 9
GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation factor deficiency, Vitamin K-dependent clotting factors, combined deficiency AD/AR/Digenic 13 42
GINS1 Immunodeficiency AR 4 4
GLRX5 Spasticity, childhood-onset, with hyperglycinemia AR 5 6
GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73
GP1BB Giant platelet disorder, isolated, Bernard-Soulier syndrome AD/AR 5 53
GP9 Bernard-Soulier syndrome AR 6 42
GPC3 Simpson-Golabi-Behmel syndrome XL 33 75
GPI Hemolytic anemia, nonspherocytic due to glucose phosphate isomerase deficiency AR 11 41
GPR101 Pituitary adenoma, growth hormone secreting, 2 XL 17
GPR143 Nystagmus, congenital, Ocular albinism XL 22 181
GREM1 Hereditary mixed polyposis syndrome AD/AR 1 8
GSS Glutathione synthetase deficiency AR 8 38
HAVCR2 AR
HAX1 Neutropenia, severe congenital AR 11 21
HBA1* Alpha-thalassemia (Hemoglobin Bart syndrome), Alpha-thalassemia (Hemoglobin H disease) AR/Digenic 27 214
HBA2#* Alpha-thalassemia (Hemoglobin Bart syndrome), Alpha-thalassemia (Hemoglobin H disease) AR/Digenic 44 290
HBB Sickle cell disease, Thalassemia-beta, dominant inclusion body, Other Thalassemias/Hemoglobinopathies, Beta-thalassemia, Hereditary persistence of fetal hemogoblin AD/AR/Digenic 242 865
HFE Hemochromatosis AR/Digenic 11 56
HK1# Hemolytic anemia, nonspherocytic, due to hexokinase deficiency, Retinitis pigmentosa 79, Neuropathy, motor and sensory, Russe type (Charcot-Marie-Tooth disease type 4G) AD/AR 9 7
HMOX1 Heme oxygenase 1 deficiency AR 2 5
HNF1A Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis AD 78 528
HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1
HOXB13 Familial prostate cancer AD 1 5
HPS1* Hermansky-Pudlak syndrome AR 28 55
HPS3 Hermansky-Pudlak syndrome AR 10 17
HPS4 Hermansky-Pudlak syndrome AR 16 22
HPS5 Hermansky-Pudlak syndrome AR 20 31
HPS6 Hermansky-Pudlak syndrome AR 13 37
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
IFNGR2 Immunodeficiency AR 4 18
IKZF1 Immunodeficiency, common variable, 13 AD 10 35
ITGA2 Fetal and neonatal alloimmune thrombocytopenia AD/AR 5
ITGA2B Glanzmann thrombasthenia AD/AR 22 234
ITGB3 Bleeding disorder, platelet-type 15, Thrombocytopenia, neonatal alloimmune, Glanzmann thrombasthenia AD/AR 18 165
ITK Lymphoproliferative syndrome AR 4 11
JAGN1 Neutropenia, severe congenital AR 8 8
JAK2 Thrombocythemia 3 AD 12 22
KCNN4 Dehydrated hereditary stomatocytosis 2 AD 3 3
KIF1B Pheochromocytoma, Neuroblastoma, Charcot-Marie-Tooth disease, type 2A1 AD 7 12
KIF23 Anemia, dyserythropoietic congenital AD 1 3
KIT Gastrointestinal stromal tumor, Piebaldism AD 79 116
KITLG Hyperpigmentation with or without hypopigementation, familial progressive, Deafness, autosomal dominant 69, Waardenburg syndrome AD/AR 6 10
KLF1 Anemia, dyserythropoietic congenital, Blood group, Lutheran inhibitor, Hereditary persistence of fetal hemoglobin AD/BG 16 45
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LAMTOR2 Immunodeficiency due to defect in MAPBP-interacting protein AR 1 1
LMAN1 Combined factor V and VIII deficiency AR 5 37
LPIN2 Majeed syndrome AR 12 14
LYST Chediak-Higashi syndrome AR 50 97
LZTR1 Schwannomatosis, Noonan syndrome AD/AR 34 71
MAGT1 Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 XL 8 14
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MASTL Thrombocytopenia AD 5
MAX Pheochromocytoma AD 13 31
MCFD2 Factor V & Factor VIII, combined deficiency of AR 8 20
MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 263 730
MET Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to AD/AR 20 34
MITF Tietz albinism-deafness syndrome, Waardenburg syndrome, Coloboma, osteopetrosis, microphthalmia, macrocephaly, albinism, and deafness (COMMAD) AD/AR 32 58
MKL1 Primary immunodeficiency AR 4
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MLH3 Colorectal cancer, hereditary nonpolyposis, Endometrial carcinoma AD/AR 7 31
MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55
MRE11A Ataxia-telangiectasia-like disorder-1 AR 57 56
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH3 Endometrial carcinoma, Colorectal adenomatous polyposis, autosomal recessive, with pilomatricomas AR 4 22
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
MTHFD1 Severe combined immunodeficiency AR 9 11
MTR Methylmalonic acidemia AR 13 43
MUTYH Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas AR 134 168
MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 AD 25 117
MYO5A Griscelli syndrome AR 7 9
NAF1 AD 2
NBEAL2 Gray platelet syndrome AR 10 51
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NF2 Schwannomatosis, Neurofibromatosis AD 66 433
NHP2 Dyskeratosis congenita AR 5 3
NOP10 Dyskeratosis congenita AR 1 1
NRAS Noonan syndrome AD 31 14
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 329 517
NSUN2 Dubowitz syndrome, Non-syndromic intellectual disability AR 8 7
NT5C3A Uridine 5-prime monophosphate hydrolase deficiency, hemolytic anemia due to AR 10 28
NTHL1 Familial adenomatous polyposis 3 AR 7 3
OBFC1 2 2
OCA2 Albinism, brown oculocutaneous, Albinism, oculocutaneous, Skin/hair/eye pigmentation AR 43 310
P2RY12 Bleeding disorder, platelet-type 15 AD/AR 4 13
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PARN* Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 15 29
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PC Pyruvate carboxylase deficiency AR 32 41
PDGFRA# Gastrointestinal stromal tumor AD 22 19
PDHA1 Leigh syndrome, Pyruvate dehydrogenase E1-alpha deficiency XL 66 192
PDHX Pyruvate dehydrogenase E3-binding protein deficiency AR 14 22
PGK1 Phosphoglycerate kinase 1 deficiency XL 16 26
PGM3 Immunodeficiency 23 AR 14 15
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 11 86
PIEZO1 Dehydrated hereditary stomatocytosis, Lympehedema, hereditary III AD/AR 23 60
PKLR Pyruvate kinase deficiency, Elevation of red blood cell ATP levels, familial AD/AR 17 277
PMS1# Hereditary nonpolyposis colon cancer AD/AR 1 32
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
POLD1 Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency AD/AR 3 31
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 70
POLH* Xeroderma pigmentosum, variant type AR 20 78
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 34
PPM1D Intellectual developmental disorder AD 16 60
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PRKACG Bleeding disorder, platelet-type, 19 AR 1 1
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PROC Thrombophilia, hereditary AD/AR 36 387
PROS1* Thrombophilia, hereditary AD/AR 23 416
PTCH1 Basal cell nevus syndrome AD 193 522
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
PUS1 Mitochondrial myopathy and sideroblastic anemia AR 7 9
RAB27A Griscelli syndrome, Elejalde syndrome AR 18 54
RAC2 Neutrophil immunodeficiency syndrome AD 2 3
RAD50 Breast cancer, Nijmegen breakage syndrome-like disorder AD/AR 183 88
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RAD51D Breast-ovarian cancer, familial AD 77 78
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 45 53
RASA2 Noonan syndrome AD 1 3
RASGRP2 Bleeding disorder, platelet-type, 18 AR 3 20
RB1 Retinoblastoma AD 266 1102
RBM8A* Thrombocytopenia - absent radius AR 5 12
RECQL* Breast cancer AD 9 27
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
REN Hyperuricemic nephropathy, Hyperproreninemia, familial, Renal tubular dysgenesis AD/AR 9 18
REST Fibromatosis, gingival, 5, Wilms tumor 6, susceptibility to AD 3 16
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD 122 407
RHAG Overhydrated hereditary stomatocytosis, Anemia, hemolytic, Rh-null, regulator type, Anemia, hemolytic,Rh-Mod type, RHAG blood group AD/AR/BG 13 28
RHBDF2 Tylosis with esophageal cancer AD 2 4
RIT1 Noonan syndrome AD 23 26
RNF168 RIDDLE syndrome AR 4 5
RPL11 Diamond-Blackfan anemia AD 12 45
RPL15* Diamond-Blackfan anemia AD 2 2
RPL26 Diamond-Blackfan anemia 11 AD 2 1
RPL27 Diamond-Blackfan anemia 16 1 1
RPL31 Diamond-Blackfan anemia AD 2
RPL35A Diamond-Blackfan anemia AD 7 14
RPL5 Diamond-Blackfan anemia AD 19 77
RPS10 Diamond-Blackfan anemia AD 3 5
RPS19 Diamond-Blackfan anemia AD 23 172
RPS20 Colorectal cancer AD 1
RPS24 Diamond-Blackfan anemia AD 6 10
RPS26 Diamond-Blackfan anemia AD 10 33
RPS28 Diamond-Blackfan anemia 15 with mandibulofacial dysostosis AD 1 1
RPS29 Diamond-Blackfan anemia AD 4 4
RPS7 Diamond-Blackfan anemia AD 2 10
RRAS Noonan-syndrome like phenotype AD/AR 2
RTEL1 Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 58 51
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AR 19 90
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 54 87
SDHAF2 Paragangliomas AD 4 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 151 272
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 29 60
SDHD# Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 68 170
SEC23B Anemia, dyserythropoietic congenital AR 18 121
SERPINC1 Antithrombin III deficiency AD/AR 44 412
SERPINF2 Alpha-2-plasmin inhibitor deficiency AD/AR 4 8
SFTPB Surfactant metabolism dysfunction, pulmonary AR 5 28
SFTPC Surfactant metabolism dysfunction, pulmonary AD 8 82
SH2D1A Lymphoproliferative syndrome XL 21 129
SHOC2 Noonan-like syndrome with loose anagen hair AD 2 4
SLC11A2 Anemia, hypochromic microcytic, with iron overload AR 5 10
SLC19A2 Thiamine-responsive megaloblastic anemia syndrome AR 14 51
SLC25A38 Anemia, sideroblastic 2, pyridoxine-refractory AR 7 27
SLC37A4 Glycogen storage disease AD/AR 49 113
SLC45A2 Skin/hair/eye pigmentation, Oculocutaneous albinism AR 16 156
SLC46A1 Folate malabsorption AR 17 23
SLC4A1 Spherocytosis, Ovalcytosis, Renal tubular acidosis, distal, with hemolytic anemia, Cryohydrocytosis, Acanthocytosis, Band 3 Memphis AD/AR/BG 38 122
SLFN14 Thrombocytopenia AD 4 4
SLX4 Fanconi anemia AR 18 72
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMARCA4 Rhabdoid tumor predisposition syndrome AD 76 57
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 AD 36 118
SMARCD2 Specific granule defiency 2 AR 3 1
SMARCE1 Coffin-Siris syndrome AD 14 12
SOS1 Noonan syndrome AD 44 71
SOS2 Noonan syndrome 9 AD 4 6
SPRED1 Legius syndrome AD 38 71
SPTA1 Spherocytosis, Ellipsocytosis, Pyropoikilocytosis AD/AR 29 51
SPTB Spherocytosis, Anemia, neonatal hemolytic, Ellipsocytosis AD/AR 24 99
SRC Thrombocytopenia, autosomal dominant, 6 AD 2 1
SRP54 Shwachman-Diamond syndrome AD 3
SRP72* Bone marrow failure syndrome 1 AD 2 5
STAT3 Hyper-IgE recurrent infection syndrome, Autoimmune disease, multisystem, infantile onset AD 47 152
STK11 Peutz-Jeghers syndrome AD 173 460
STX11 Hemophagocytic lymphohistiocytosis, familial AR 8 22
STXBP2 Hemophagocytic lymphohistiocytosis, familial AR 12 77
SUFU Medulloblastoma, Basal cell nevus syndrome AD 22 44
TBXA2R Bleeding disorder, platelet-type 15 AD 1 6
TBXAS1 Ghosal hematodiaphyseal syndrome AR 7 6
TCN2 Transcobalamin II deficiency AR 9 35
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
TF Atransferrinemia AR 8 17
THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical AD 5 28
THPO Thrombocythemia 1 AD/AR 5 10
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TMEM127 Pheochromocytoma AD 30 52
TMPRSS6 Iron-refractory iron deficiency anemia AR 13 102
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
TPI1 Triosephosphate isomerase deficiency AR 8 19
TRIP13 Mosaic variegated aneuploidy syndrome 3 2 2
TRNT1 Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay AR 13 26
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195
TUBB1 Macrothrombocytopenia AD 2 7
TYR* Albinism, oculocutaneous AR 77 441
TYRP1 Albinism, oculocutaneous AR 10 55
UBE2T Fanconi anemia, complementation group T AR 2 7
UNC13D Hemophagocytic lymphohistiocytosis, familial AR 22 192
USB1 Poikiloderma with neutropenia AR 24 22
VHL Erythrocytosis, familial, Pheochromocytoma, Von Hippel-Lindau disease AD/AR 206 614
VKORC1# Drug metabolism, VKORC1-related, Vitamin K-dependent clotting factors, combined deficiency AD/AR 4 27
VPS13B Cohen syndrome AR 351 203
VPS45# Neutropenia, severe congenital, 5, autosomal recessive AR 3 4
VWF* Von Willebrand disease AD/AR 57 1009
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome XL 57 439
WDR1 AR 8
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3
WRAP53 Dyskeratosis congenita AR 7 6
WRN* Werner syndrome AR 64 107
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 AD 42 183
XIAP* Lymphoproliferative syndrome XL 14 96
XPA Xeroderma pigmentosum AR 49 47
XPC Xeroderma pigmentosum AR 67 91
XRCC2 Hereditary breast cancer AD/AR 10 21
YARS2 Myopathy, lactic acidosis, and sideroblastic anemia AR 27 11
ZCCHC8 1
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Hematology and Hereditary Cancer Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ABCA3 Chr16:2333457 c.3863-98C>T NM_001089.2 rs189077405
ABCA3 Chr16:2358644 c.1112-20G>A NM_001089.2 rs746701685
ABCA3 Chr16:2376495 c.-26-2A>G NM_001089.2
AIP Chr11:67250360 NM_003977.2 rs267606588
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
ALAS2 ChrX:55054634 c.-15-2186C>G NM_000032.4
ALAS2 ChrX:55054635 c.-15-2187T>C NM_000032.4
ALAS2 ChrX:55054636 c.-15-2188A>G NM_000032.4
ALAS2 ChrX:55057393 c.-34C>T NM_000032.4 rs780642606
ALAS2 ChrX:55057617 c.-258C>G NM_000032.4 rs140772352
AMN Chr14:103395424 c.514-34G>A NM_030943.3 rs144077391
AMN Chr14:103396444 c.1007-31_1006+34delCCTCGCCCCGCCGCG NM_030943.3 rs386834161
AMN Chr14:103396458 c.1007-29_1006+36delTCGCCCCGCCGCGGG NM_030943.3 rs386834162
ANK1 Chr8:41566510 c.1900-17G>A NM_001142446.1 rs786205243
ANK1 Chr8:41566511 c.1900-18C>A NM_001142446.1
ANK1 Chr8:41655127 c.-73_-72delTG NM_020476.2 rs786205242
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
APC Chr5:112043009-112043595
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043223 c.-192A>G NM_001127511.2 rs879253784
APC Chr5:112043223 c.-192A>T NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112072710-112073585
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BAP1 Chr3:52435659 c.*644delG NM_004656.3
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
BUB1B Chr15:40409289 c.-44133G>A NM_001211.5 rs576524605
BUB1B Chr15:40504689 c.2386-11A>G NM_001211.5 rs751421137
CDH1 Chr16:68842843 c.687+92T>A NM_004360.3
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21972311 c.151-1104C>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
CECR1 Chr22:17664763 c.1082-1113delA NM_017424.2
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
CTSC Chr11:88070895 c.-55C>A NM_001814.4 rs766114323
CUBN Chr10:17088532 c.3330-439C>G NM_001081.3 rs386833782
CYLD Chr16:50813428 c.1139-148A>G NM_015247.2
DICER1 Chr14:95559038 c.5364+1187T>G NM_177438.2
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
ERCC1 Chr19:45918244 c.603-26G>A NM_202001.2 rs367887072
ERCC5 Chr13:103514354 c.881-26T>G NM_000123.3
F11 Chr4:187186995 c.-456G>A NM_000128.3
F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853
F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976
F12 Chr5:176836590 NM_000505.3 rs187018744
F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3
F2 Chr11:46742048 c.241-25C>G NM_000506.3
F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963
F2 Chr11:46761064 c.*106T>A NM_000506.3
F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
F7 Chr13:113760060 c.-96C>T NM_000131.4
F7 Chr13:113760062 c.-94C>G NM_000131.4
F7 Chr13:113760091 c.-65G>C NM_000131.4
F7 Chr13:113760094 NM_000131.4
F7 Chr13:113760094 c.-62C>T NM_000131.4
F7 Chr13:113760095 c.-61T>G NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760097 c.-59T>G NM_000131.4
F7 Chr13:113760099 c.-57C>T NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666
F7 Chr13:113760117 c.-39A>G NM_000131.4
F7 Chr13:113760124 c.-32A>C NM_000131.4 rs761212787
F7 Chr13:113760126 c.-30A>C NM_000131.4 rs539578931
F7 Chr13:113764993 c.131-11G>A NM_000131.4
F7 Chr13:113766228 c.291+1065delC NM_000131.4
F7 Chr13:113770192 c.571+78G>A NM_000131.4 rs764741909
F7 Chr13:113771068 c.572-12T>A NM_000131.4
F8 ChrX:154084603 c.6900+4104A>T NM_000132.3
F8 ChrX:154091516 c.6430-14A>G NM_000132.3
F8 ChrX:154130453 c.5999-11G>A NM_000132.3 rs782132907
F8 ChrX:154130463 c.5999-23_5999-22delCT NM_000132.3
F8 ChrX:154130464 c.5999-33_5999-22delGAAATAATTTCTinsATTC NM_000132.3
F8 ChrX:154130469 c.5999-33_5999-28delGAAATA NM_000132.3
F8 ChrX:154130719 c.5999-277G>A NM_000132.3
F8 ChrX:154131240 c.5999-798G>A NM_000132.3
F8 ChrX:154132376 c.5816-14_5816-13delGTinsTA NM_000132.3
F8 ChrX:154132397 c.5816-34A>T NM_000132.3 rs782301004
F8 ChrX:154132892 c.5587-93C>T NM_000132.3
F8 ChrX:154134863 c.5220-16_5220-15insA NM_000132.3
F8 ChrX:154174820 c.2113+1152delA NM_000132.3
F8 ChrX:154175961 c.2113+12T>A NM_000132.3
F8 ChrX:154176219 c.1904-37G>A NM_000132.3 rs367615232
F8 ChrX:154185464 c.1538-18G>A NM_000132.3
F8 ChrX:154189025 c.1537+325A>G NM_000132.3
F8 ChrX:154189458 c.1444-15C>A NM_000132.3
F8 ChrX:154197841 c.788-14T>G NM_000132.3
F8 ChrX:154213089 c.671-11T>C NM_000132.3
F8 ChrX:154215591 c.602-11T>G NM_000132.3
F8 ChrX:154215612 c.602-32A>G NM_000132.3
F8 ChrX:154219579 c.601+1632G>A NM_000132.3 rs387906429
F8 ChrX:154221439 c.389-16T>G NM_000132.3
F8 ChrX:154227886 c.144-11T>G NM_000132.3
F8 ChrX:154227901 c.144-26A>T NM_000132.3
F8 ChrX:154238632 c.144-10758_144-10757insTATA NM_000132.3
F8 ChrX:154249118 c.143+1567A>G NM_000132.3
F8 ChrX:154250939 c.-112G>A NM_000132.3 rs1317271565
F8 ChrX:154251045 NM_000132.3
F8 ChrX:154251045 c.-218T>C NM_000132.3
F8 ChrX:154251046 c.-219C>T NM_000132.3
F8 ChrX:154251048 c.-221T>A NM_000132.3
F8 ChrX:154251082 c.-255A>G NM_000132.3
F8 ChrX:154251084 c.-257T>C/G NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251687 c.-860A>G NM_000132.3
F8 ChrX:154251793 c.-966G>T NM_000132.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3
F9 ChrX:138612871 c.-53A>G NM_000133.3
F9 ChrX:138612871 NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612872 c.-52C>G/T NM_000133.3
F9 ChrX:138612874 c.-50T>C/G NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612875 NM_000133.3
F9 ChrX:138612875 NM_000133.3 rs1178811105
F9 ChrX:138612875 c.-49T>A/C NM_000133.3
F9 ChrX:138612876 c.-48G>C NM_000133.3
F9 ChrX:138612886 c.-38A>G NM_000133.3
F9 ChrX:138612889 c.-35G>A/C NM_000133.3
F9 ChrX:138612889 NM_000133.3 rs1166164399
F9 ChrX:138612889 NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612890 c.-34A>G/T NM_000133.3
F9 ChrX:138612899 c.-22delT NM_000133.3
F9 ChrX:138612900 c.-24T>A NM_000133.3
F9 ChrX:138612901 c.-23T>C NM_000133.3
F9 ChrX:138612902 c.-22T>C NM_000133.3
F9 ChrX:138612903 c.-21C>G NM_000133.3
F9 ChrX:138612905 c.-19C>G NM_000133.3
F9 ChrX:138612905 c.-17delA NM_000133.3
F9 ChrX:138612906 c.-18A>T NM_000133.3
F9 ChrX:138612906 c.-18A>G NM_000133.3
F9 ChrX:138612906 c.-18A>G/T NM_000133.3
F9 ChrX:138612907 c.-17A>C/G NM_000133.3
F9 ChrX:138612907 c.-17A>C NM_000133.3
F9 ChrX:138612907 c.-17A>G NM_000133.3
F9 ChrX:138619496 c.253-25A>T NM_000133.3
F9 ChrX:138619496 c.253-25A>G NM_000133.3 rs1201753038
F9 ChrX:138619496 c.253-25A>G/T NM_000133.3
F9 ChrX:138619501 c.253-19_253-16delCTTC NM_000133.3
F9 ChrX:138619502 c.253-16_253-12delCTTTT NM_000133.3
F9 ChrX:138623222 c.278-13A>G NM_000133.3
F9 ChrX:138623223 c.278-12C>G/T NM_000133.3
F9 ChrX:138623223 c.278-12C>G NM_000133.3
F9 ChrX:138623223 c.278-12C>T NM_000133.3 rs1475223858
F9 ChrX:138630499 c.392-22_392-21delCT NM_000133.3
F9 ChrX:138630663 c.520+13A>G NM_000133.3
F9 ChrX:138633441 c.723+18T>A NM_000133.3
F9 ChrX:138645387 c.*1157A>G NM_000133.3
F9 ChrX:138645598 c.*1368A>G NM_000133.3
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCA Chr16:89864654 c.893+920C>A NM_000135.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCD2 Chr3:10102127 c.1766+40T>G NM_033084.3
FANCD2 Chr3:10106024 c.1948-16T>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
FANCL Chr2:58433394 c.375-2033C>G NM_001114636.1
FAS Chr10:90770494 c.506-16A>G NM_000043.4
FASLG Chr1:172628081 c.-261T>C NM_000639.1
FGB Chr4:155486360 c.115-600A>G NM_005141.4
FGB Chr4:155490472 c.958+13C>T NM_005141.4 rs606231223
FGG Chr4:155527225 c.1129+632A>G NM_021870.2 rs2066862
FGG Chr4:155527787 c.1129+66_1129+69delAATA NM_021870.2 rs139788771
FGG Chr4:155530122 c.667-320A>T NM_021870.2
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3
GBA Chr1:155208109 c.589-12C>G NM_000157.3
GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445
GINS1 Chr20:25388397 c.-60A>G NM_021067.3
GINS1 Chr20:25388409 c.-48C>G NM_021067.3
GP1BB Chr22:19710933 c.-160C>G NM_000407.4 rs730882059
GPR143 ChrX:9708630 c.885+748G>A NM_000273.2
GPR143 ChrX:9711844 c.659-131T>G NM_000273.2
GSS Chr20:33537864 c.129+1663A>G NM_000178.2
GSS Chr20:33543525 c.-9+5G>A NM_000178.2
HBA1 Chr16:227471 c.*63_*65delCCT NM_000558.3
HBA2 Chr16:223646 c.*47G>C NM_000517.4 rs4021971
HBA2 Chr16:223672 c.*74_*89delCCTTCCTGGTCTTTGA NM_000517.4 rs63750919
HBA2 Chr16:223690 c.*93_*94delAA NM_000517.4 rs63751268
HBA2 Chr16:223691 c.*92A>G NM_000517.4 rs63750067
HBA2 Chr16:223693 c.*94A>G NM_000517.4
HBA2 Chr16:223693 c.*94A>C NM_000517.4
HBA2 Chr16:223703 c.*104G>T NM_000517.4
HBB Chr11:5246696 c.*132C>A/T NM_000518.4
HBB Chr11:5246696 c.*132C>A NM_000518.4 rs1420779550
HBB Chr11:5246696 c.*132C>T NM_000518.4
HBB Chr11:5246699 c.*129T>C NM_000518.4
HBB Chr11:5246711 c.*115_*116delAA NM_000518.4 rs281864532
HBB Chr11:5246713 c.*110_*114delTAAAA NM_000518.4 rs606231219,rs35949130
HBB Chr11:5246715 c.*113A>G NM_000518.4 rs33985472
HBB Chr11:5246716 c.*112A>G/T NM_000518.4 rs63750954
HBB Chr11:5246716 c.*112A>T NM_000518.4
HBB Chr11:5246716 c.*112A>G NM_000518.4
HBB Chr11:5246716 c.*110_*111delTA NM_000518.4 rs63750205,rs281864905
HBB Chr11:5246717 c.*111A>G NM_000518.4 rs63751128
HBB Chr11:5246718 c.*110T>A/C NM_000518.4 rs33978907
HBB Chr11:5246718 c.*110T>G NM_000518.4
HBB Chr11:5246720 c.*108A>C/G NM_000518.4
HBB Chr11:5246720 c.*108A>C NM_000518.4
HBB Chr11:5246720 c.*108A>G NM_000518.4
HBB Chr11:5246722 c.*93_*105delATCTGGATTCTGC NM_000518.4 rs34171453
HBB Chr11:5246732 c.*96T>C NM_000518.4 rs34029390
HBB Chr11:5246754 c.*74A>G NM_000518.4 rs369101035
HBB Chr11:5246781 c.*47C>G NM_000518.4
HBB Chr11:5246796 c.*32A>C NM_000518.4
HBB Chr11:5246970 c.316-14T>G NM_000518.4 rs35703285
HBB Chr11:5247046 c.316-90A>G NM_000518.4 rs63750433
HBB Chr11:5247062 c.316-106C>G NM_000518.4 rs34690599
HBB Chr11:5247102 c.316-146T>G NM_000518.4 rs35328027
HBB Chr11:5247153 c.316-197C>T NM_000518.4 rs34451549
HBB Chr11:5247216 c.316-260T>C NM_000518.4
HBB Chr11:5247602 c.315+203_315+205delTCTinsCC NM_000518.4
HBB Chr11:5248044 c.93-15T>G NM_000518.4 rs35456885
HBB Chr11:5248050 c.93-21G>A NM_000518.4 rs35004220
HBB Chr11:5248050 c.93-22delT NM_000518.4
HBB Chr11:5248263 c.-12C>T NM_000518.4 rs113115948
HBB Chr11:5248269 c.-18C>G NM_000518.4 rs34135787
HBB Chr11:5248272 c.-21T>A NM_000518.4
HBB Chr11:5248280 c.-29G>A/T NM_000518.4 rs34704828
HBB Chr11:5248281 c.-31delC NM_000518.4
HBB Chr11:5248282 c.-31C>T NM_000518.4 rs63750628
HBB Chr11:5248291 c.-41delT NM_000518.4 rs35352549
HBB Chr11:5248294 c.-43C>T NM_000518.4
HBB Chr11:5248301 c.-50A>C NM_000518.4 rs34305195
HBB Chr11:5248301 c.-50A>G/T NM_000518.4
HBB Chr11:5248326 c.-75G>T NM_000518.4
HBB Chr11:5248326 c.-75G>C NM_000518.4 rs63750400
HBB Chr11:5248326 NM_000518.4 rs63750953
HBB Chr11:5248327 c.-76A>C NM_000518.4 rs281864525
HBB Chr11:5248328 c.-77A>G/T NM_000518.4
HBB Chr11:5248328 NM_000518.4
HBB Chr11:5248328 NM_000518.4
HBB Chr11:5248329 NM_000518.4
HBB Chr11:5248329 NM_000518.4
HBB Chr11:5248329 c.-78A>C/G NM_000518.4 rs33931746
HBB Chr11:5248330 c.-79A>G NM_000518.4 rs34598529
HBB Chr11:5248330 NM_000518.4 rs397509430
HBB Chr11:5248331 NM_000518.4
HBB Chr11:5248331 NM_000518.4
HBB Chr11:5248331 c.-80T>A/C NM_000518.4 rs33980857
HBB Chr11:5248332 c.-81A>C/G NM_000518.4 rs33981098
HBB Chr11:5248332 NM_000518.4
HBB Chr11:5248332 NM_000518.4
HBB Chr11:5248333 NM_000518.4
HBB Chr11:5248333 NM_000518.4
HBB Chr11:5248333 c.-82C>A/T NM_000518.4 rs34500389
HBB Chr11:5248342 c.-91A>C NM_000518.4
HBB Chr11:5248343 c.-92C>G NM_000518.4 rs397515291
HBB Chr11:5248351 c.-100G>A NM_000518.4 rs281864524
HBB Chr11:5248372 c.-121C>T NM_000518.4 rs281864518
HBB Chr11:5248373 NM_000518.4 rs1272414751
HBB Chr11:5248374 c.-123A>T NM_000518.4
HBB Chr11:5248377 c.-126C>A NM_000518.4
HBB Chr11:5248378 c.-127G>C NM_000518.4
HBB Chr11:5248384 NM_000518.4 rs72561473
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 c.-136C>A/G/T NM_000518.4 rs33994806
HBB Chr11:5248388 c.-137C>A/G/T NM_000518.4 rs33941377
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248389 NM_000518.4
HBB Chr11:5248389 NM_000518.4
HBB Chr11:5248389 c.-138C>A/T NM_000518.4 rs33944208
HBB Chr11:5248391 NM_000518.4 rs34999973
HBB Chr11:5248393 c.-142C>T NM_000518.4 rs34883338
HBB Chr11:5248394 c.-143C>G NM_000518.4 rs63751043
HBB Chr11:5248402 c.-151C>T NM_000518.4 rs63751208
HBB Chr11:5248402 NM_000518.4
HBB Chr11:5248403 c.-152C>A NM_000518.4
HBB Chr11:5248491 c.-240G>A NM_000518.4 rs753344875
HBB Chr11:5248524 c.-273T>C NM_000518.4 rs139703273
HFE Chr6:26087649 c.-20G>A NM_000410.3 rs138378000
HK1 Chr10:71038447 c.-390-3838G>C NM_033500.2 rs797044964
HK1 Chr10:71038467 c.-390-3818G>C NM_033500.2 rs397514654
HK1 Chr10:71075518 c.27+14901A>G NM_033500.2 rs187500777
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416285 NM_000545.5
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416385 NM_000545.5
HNF1A Chr12:121416385 NM_000545.5 rs970766228
HNF1A Chr12:121416391 NM_000545.5
HNF1A Chr12:121416437 NM_000545.5
HNF1A Chr12:121416446 NM_000545.5 rs780586155
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
HNF1A Chr12:121416508 NM_000545.5
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
ITGA2B Chr17:42449567 c.*165T>C NM_000419.3
ITGA2B Chr17:42455177 c.2095-19T>A NM_000419.3
ITGA2B Chr17:42458507 c.1211-78A>G NM_000419.3
ITGA2B Chr17:42463181 c.408+11C>A NM_000419.3
ITGA2B Chr17:42470923 c.-4082G>A NM_000419.3
KLF1 Chr19:12998078 c.-124T>C NM_006563.3
KLF1 Chr19:12998102 NM_006563.3 rs552824864
KLF1 Chr19:12998108 c.-154C>T NM_006563.3 rs372651309
LAMTOR2 Chr1:156028185 c.*23C>A NM_014017.3
LMAN1 Chr18:57014710 c.822+34_822+35insGTTG NM_005570.3
LZTR1 Chr22:21336623 c.-38T>A NM_006767.3
LZTR1 Chr22:21350968 c.2220-17C>A NM_006767.3 rs1249726034
MEN1 Chr11:64571394 c.*412G>A NM_000244.3
MEN1 Chr11:64575165 c.670-15_670-14delTC NM_000244.3
MEN1 Chr11:64577602 c.-23-11_-22delTTGCCTTGCAGGC NM_000244.3
MEN1 Chr11:64577603 c.-23_-22insT NM_000244.3
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
MTR Chr1:236971838 c.340-166A>G NM_000254.2
MTR Chr1:236977232 c.609+1088G>A NM_000254.2 rs752526782
MTR Chr1:237057461 c.3205-196A>G NM_000254.2 rs544410324
MUTYH Chr1:45797534 c.998-13T>G NM_001128425.1
MUTYH Chr1:45798558 c.504+19_504+31delTAGGGGAAATAGG NM_001128425.1 rs781222233
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NSUN2 Chr5:6622224 c.538-11T>G NM_017755.5
OCA2 Chr15:28234823 c.1117-11T>A NM_000275.2
OCA2 Chr15:28234829 c.1117-17T>C NM_000275.2 rs200081580
OCA2 Chr15:28235808 c.1045-15T>G NM_000275.2 rs779461179
OCA2 Chr15:28267738 c.574-19A>G NM_000275.2 rs145242923
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PARN Chr16:14724045 c.-165+2C>T NM_001134477.2
PC Chr11:66620883 c.1369-29A>G NM_000920.3
PDGFRA Chr4:55161473 c.*34G>A NM_006206.4 rs552950826
PDHA1 ChrX:19371182 c.533-17_533-14delTGTT NM_001173454.1
PDHA1 ChrX:19372579 c.625-30G>A NM_001173454.1
PDHA1 ChrX:19373648 c.873+26G>A NM_001173454.1
PDHA1 ChrX:19377849 c.*79_*90dupAGTCAATGAAAT NM_001173454.1 rs606231192
PDHA1 ChrX:19377861 c.*79_*90dupAGTCAATGAAAT NM_001173454.1
PDHX Chr11:34988372 c.816+11C>G NM_003477.2
PGK1 ChrX:77381262 c.1214-25T>G NM_000291.3
PKLR Chr1:155263185 c.1269+44C>T NM_000298.5
PKLR Chr1:155265208 c.507+20C>A NM_000298.5
PKLR Chr1:155271258 c.-72A>G NM_000298.5
PKLR Chr1:155271259 c.-73G>C NM_000298.5
PKLR Chr1:155271269 c.-83G>C NM_000298.5
PKLR Chr1:155271269 NM_000298.5 rs1460844860
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
POLE Chr12:133249181 c.1686+32C>G NM_006231.2 rs762985435
POLH Chr6:43544178 c.-5+1G>C NM_006502.2
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89622883-89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RB1 Chr13:48877814 NM_000321.2 rs576931877
RB1 Chr13:48877836 NM_000321.2
RB1 Chr13:48877837 c.-212G>A NM_000321.2
RB1 Chr13:48877851 c.-198G>A NM_000321.2 rs387906521
RB1 Chr13:48877851 c.-198G>T NM_000321.2
RB1 Chr13:48877852 c.-197G>A NM_000321.2
RB1 Chr13:48877853 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 NM_000321.2
RB1 Chr13:48877856 c.-193T>A/G NM_000321.2
RB1 Chr13:48877857 c.-192G>A NM_000321.2
RB1 Chr13:48877860 c.-189G>T NM_000321.2 rs387906520
RB1 Chr13:48877899 c.-150G>C NM_000321.2
RB1 Chr13:48877900 c.-149G>T NM_000321.2
RB1 Chr13:48921946 c.501-15T>G NM_000321.2
RB1 Chr13:48930735 c.608-3418A>G NM_000321.2
RB1 Chr13:48937921 c.861+828T>G NM_000321.2
RB1 Chr13:48947691 c.1215+63T>G NM_000321.2
RB1 Chr13:48954175 c.1390-14A>G NM_000321.2 rs9535023
RB1 Chr13:48954239 c.1421+20_1421+33delTAAAAAATTTTTTT NM_000321.2
RB1 Chr13:49027115 c.1696-14C>T NM_000321.2 rs776912915
RB1 Chr13:49027117 c.1696-12T>G NM_000321.2
RB1 Chr13:49030329 c.1815-11A>G NM_000321.2
RB1 Chr13:49039121 c.2212-13T>A NM_000321.2
RB1 Chr13:49039327 c.2326-14T>C NM_000321.2
RB1 Chr13:49046098 c.2490-1398A>G NM_000321.2
RB1 Chr13:49047468 c.2490-28T>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C/G/T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>C NM_000321.2
RB1 Chr13:49047470 c.2490-26A>T NM_000321.2
RB1 Chr13:49047470 c.2490-26A>G NM_000321.2
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
REN Chr1:204129817 c.374-12_374-11delTCinsAG NM_000537.3
REST Chr4:57793760 c.983-2247C>G NM_005612.4
RET Chr10:43572670 c.-37G>C NM_020975.4 rs751005619
RET Chr10:43572680 c.-27C>G NM_020975.4
RET Chr10:43582162 c.73+9385_73+9395delAGCAACTGCCA NM_020975.4 rs368137511
RET Chr10:43606948 c.1522+35C>T NM_020975.4 rs377130948
RET Chr10:43612192 c.2284+13C>T NM_020975.4
RET Chr10:43612198 c.2284+19C>T NM_020975.4
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
RPL31 Chr2:101618778 c.-1+1G>A NM_001098577.2
RPL5 Chr1:93300322 c.190-12_191dupCTCTTACTATAGAT NM_000969.3
RPS19 Chr19:42364214 c.-144_-141delTTTC NM_001022.3
RPS26 Chr12:56436176 c.4-25_4-14delTAACAGTTTTCC NM_001029.3
RPS7 Chr2:3622941 c.-19+1G>T NM_001011.3
RPS7 Chr2:3622942 c.-19+2T>C NM_001011.3
SEC23B Chr20:18488060 c.-571A>G NM_006363.4 rs559854357
SEC23B Chr20:18488615 c.-16A>G NM_006363.4
SEC23B Chr20:18491731 c.221+31A>G NM_006363.4
SEC23B Chr20:18491863 c.221+163A>G NM_006363.4 rs573898514
SEC23B Chr20:18492791 c.222-78C>T NM_006363.4 rs150393520
SEC23B Chr20:18526845 c.1743+168A>G NM_006363.4 rs111951711
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
SH2D1A ChrX:123499593 c.138-17_138-11delAGTTTAT NM_002351.4
SLC45A2 Chr5:33985176 NM_016180.3 rs984225803
SLC45A2 Chr5:33985764 NM_016180.3 rs199972025
SLC4A1 Chr17:42340296 c.-62G>A NM_000342.3 rs387906565
SMARCB1 Chr22:24130008 c.93+559A>G NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
SPTA1 Chr1:158613314 c.4339-99C>T NM_003126.2 rs200830867
SPTA1 Chr1:158626459 c.2806-13T>G NM_003126.2
STK11 Chr19:1220520 c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG NM_000455.4
STK11 Chr19:1220530 c.598-32_597+31delGCCCCCTCCCGGGC NM_000455.4
STX11 Chr6:144508713 c.*85_*86insT NM_003764.3
STXBP2 Chr19:7705761 c.326-23_326-16delGCCCCACT NM_006949.3
TCN2 Chr22:31011112 c.581-176A>T NM_000355.3
TCN2 Chr22:31011112 c.581-176A>G NM_000355.3 rs372866837
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
THBD Chr20:23030319 NM_000361.2
THBD Chr20:23030443 c.-302C>A NM_000361.2
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TRNT1 Chr3:3188088 c.609-26T>C NM_182916.2
TSC1 Chr9:135800306 c.363+668G>A NM_000368.4
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
TSC2 Chr16:2106052 c.600-145C>T NM_000548.3
TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
TYR Chr11:88960973 c.1037-18T>G NM_000372.4
UNC13D Chr17:73826245 c.2831-13G>A NM_199242.2
UNC13D Chr17:73827442 c.2448-13G>A NM_199242.2 rs753762300
UNC13D Chr17:73839907 c.118-307G>A NM_199242.2
UNC13D Chr17:73839908 c.118-308C>T NM_199242.2
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3
VHL Chr3:10191719 c.*70C>A NM_000551.3
VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225
VWF Chr12:6101204 c.6599-20A>T NM_000552.3 rs61750621
VWF Chr12:6125417 c.5312-19A>G NM_000552.3
VWF Chr12:6128923 c.3675-14G>A NM_000552.3
VWF Chr12:6233584 c.-1+3A>C NM_000552.3
VWF Chr12:6233714 c.-128G>A NM_000552.3 rs1300771136
VWF Chr12:6234258 c.-672C>T NM_000552.3 rs61750447
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4
XPA Chr9:100449555 c.390-12A>G NM_000380.3
XPC Chr3:14187285 c.*156G>A NM_004628.4 rs121965092
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

Test Strengths

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in *PTEN*.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: *CSF2RA* (NM_001161530:9), *HK1* (NM_001322365:5), *PDGFRA* (NM_001347828:2), *PMS1* (NM_001321049:4), *SDHD* (NM_001276506:4), *VKORC1* (NM_001311311:3), *VPS45* (NM_001279353:13). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Marlborough, MA, are equivalent.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists, and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost, according to our latest follow-up reporting policy.

Sickle Cell Anemia Resources

Bernard-Soulier Syndrome Resources

Bloom's Syndrome Resources

Diamond Blackfan Anemia Resources

Fanconi Anemia Resources

Glanzmann's Syndrome Resources

Hemophilia Resources

Hermansky-Pudlak Syndrome Resources

Hemophagocystic Lymphohistocytosis Resources

Immune Deficiency Resources

Platelet Disorder Resources

Shwachman-Diamond Syndrome Resources

Thalassemia Resources

Wiskott-Aldrich Syndrome Resources

Chediak-Higashi Syndrome Resources

Hereditary Spherocytosis Resources

Breast and Ovarian Cancer Resources

Gastrointestinal Cancer Resources

General Resources

Lung Cancer Resources

Bloom Syndrome Resources

Li-Fraumeni Syndrome Resources

Multiple Endocrine Neoplasia Resources

Neurofibromatosis Resources

Rothmund-Thomson Syndrome Resources

Tuberous Sclerosis Complex Resources

von Hippel Lindau Syndrome Resources

Gorlin Syndrome Resources

Other