Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) Panel

  • Is a 337 gene panel that includes assessment of non-coding variants
  • Panel is ideal for patients with a clinical suspicion of primary immunodeficiency (PID), especially, if primary ciliary dyskinesia (PCD) is considered important for differential diagnostics.

Analysis methods
  • PLUS

4 weeks

Number of genes


Test code


Panel size


CPT codes


The Blueprint Genetics Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) Panel (test code IM0801):

ICD codes

Commonly used ICD-10 code(s) when ordering the Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) Panel

ICD-10 Disease
Q34.8 Primary ciliary dyskinesia
Q34.8 Other specified congenital malformations of respiratory system
E84.0 Cystic fibrosis
N46.8 Male Infertility
Q89.3 Situs inversus
D80.9 Immunodeficiencies with antibody defects
D81.9 Combined immunodeficiencies

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Oragene DNA OG-500 kit/OGD-500 or OG-575 & OGD-575)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. Read more about our sample requirements here.

Subpanel description

This comprehensive Panel includes the following panels: Severe Combined Immunodeficiency Panel, Dyskeratosis Congenita Panel, Autoinflammatory Syndrome Panel, Congenital Neutropenia Panel, Chronic Granulomatous Disease Panel and Primary Ciliary Dyskinesia Panel.

Primary immunodeficiencies (PIDs) are a genetically heterogeneous group of diseases. The International Union of Immunological Societies Expert Committee categorizes PIDs into nine different categories: 1) combined immunodeficiencies, 2) combined immunodeficiencies with associated or syndromic features, 3) predominantly antibody deficiencies, 4) diseases of immune dysregulation, 5) congenital defects of phagocyte number, function, or both, 6) defects in intrinsic and innate immunity, 7) autoinflammatory disorders, 8) complement deficiencies and 9) phenocopies of PIDs. Despite a heterogeneous genetic basis, the core symptoms are often very similar and can complicate the diagnosis. In addition, many PIDs may be included in more than one category. Without knowing the specific mutation in the causative gene, treatment choice can be a complicated process. Also, type and site of and specific organisms causing the infections may help to classify the disease. In addition to immune-related symptoms, many PIDs have non-immune manifestations. The prevalence of individual PIDs have a wide range, but the combined prevalence of all primary immunodeficiencies is reported to be as high as 5-8:10,000. Some recently identified PIDs are extremely rare.

Primary ciliary dyskinesia (PCD) is a disorder characterized by chronic respiratory tract infections, situs abnormalities (situs ambiguous and situs inversus), and sometimes infertility due to abnormal sperm motility. The signs and symptoms of this condition are caused by abnormal cilia. Affected patients may have signs of PCD at birth or within the first few months of life; however, the symptoms and disease onset vary depending on the underlying genetic defect. Most full-term neonates have respiratory distress with tachypnea (infant acute respiratory distress syndrome). Typical findings in infants and children include daily rhinitis and daily year-round wet cough occurring soon after birth with associated recurrent or chronic infections of the lower airways. Patients with PCD, especially young children, may also experience recurrent ear infections (otitis media). The prevalence of PCD is difficult to determine. Among population isolates with a high rate of consanguinity, the incidence rate may be especially high. The total number of individuals with PCD in the United States is estimated to be 12,000-17,000. PCD has an estimated incidence of 1:15,000-1:30,000 live births; however, this is probably an underestimate. The Primary Ciliary Dyskinesia Panel includes testing for cystic fibrosis (CF), which is characterized by the production of sweat with a high salt content and mucus secretions with an abnormal viscosity. CF is caused by mutations in the CFTR gene. The disease is chronic and generally progressive, with onset usually occurring during early childhood.

Genes in the Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ACD Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 AD/AR 2 8
ACP5 Spondyloenchondrodysplasia with immune dysregulation AR 12 26
ACTB* Baraitser-Winter syndrome AD 55 60
ADA Severe combined immunodeficiency due to adenosine deaminase deficiency AR 49 93
ADAM17 Inflammatory skin and bowel disease, neonatal 1 AR 1 7
ADAR Dyschromatosis symmetrica hereditaria, Aicardi-Goutières syndrome AD/AR 25 226
AICDA Immunodeficiency with hyper-IgM AD/AR 14 50
AIRE Autoimmune polyendocrinopathy syndrome AD/AR 73 134
AK2 Reticular dysgenesis AR 14 17
ALPI Inflammatory bowel disease AR 5
AP3B1 Hermansky-Pudlak syndrome AR 14 34
ARHGEF1 Idiopathic bronchiectasis, Immunodeficiencies with antibody defects AR 1
ARMC4#* Ciliary dyskinesia AR 18 17
ARPC1B Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease AR 2 4
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATP6AP1 Immunodeficiency 47 XL 5 5
BACH2 BACH2-related immunodeficiency and autoimmunity (BRIDA) AD 2
BCL10 Immunodeficiency 37 AR 16 1
BCL11B Immunodeficiency 49 AD 8 12
BLM Bloom syndrome AR 152 119
BLNK Agammaglobulinemia 4 AR 2 3
BTK Hypogammaglobulinemia, Agammaglobulinemia and isolated hormone deficiency, Agammaglobulinemia XL 114 908
C11ORF70 Primary ciliary dyskinesia AR 5
C17ORF62 Chronic granulomatous disease AR 1
C1QA C1q deficiency AR 2 7
C1QB C1q deficiency AR 4 8
C1QC C1q deficiency AR 4 10
C1S Complement component C1s deficiency AR 4 10
C2* Complement component 2 deficiency AR 4 9
C21ORF59 Ciliary dyskinesia AR 5 4
C3 Hemolytic uremic syndrome, atypical, Complement component 3 deficiency, Macular degeneration, age-related AD/AR 6 87
CARD11 B-cell expansion with NFKB and T-cell anergy, Immunodeficiency AD/AR 12 9
CARD14 Psoriasis AD 9 29
CARD9 Candidiasis, familial, 2 AR 8 25
CASP10 Autoimmune lymphoproliferative syndrome AD 5 7
CASP8 Caspase 8 defiency AR 2 7
CCDC103 Ciliary dyskinesia AR 4 5
CCDC114 Ciliary dyskinesia AR 9 8
CCDC39 Ciliary dyskinesia AR 39 47
CCDC40 Ciliary dyskinesia AR 33 43
CCDC65 Ciliary dyskinesia AR 2 2
CCNO Ciliary dyskinesia AR 11 10
CD19 Immunodeficiency, common variable AR 8 9
CD247 Immunodeficiency AR 8 4
CD27 Lymphoproliferative syndrome AR 4 8
CD3D Immunodeficiency AR 3 5
CD3E Immunodeficiency AR 4 7
CD3G Immunodeficiency AR 5 3
CD40 Immunodeficiency with Hyper-IgM AR 5 10
CD40LG Immunodeficiency, with hyper-IgM XL 35 231
CD46* Hemolytic uremic syndrome, atypical AD/AR 5 81
CD55# Blood group, Cromer system BG 7 7
CD59 CD59 deficiency AR 4 8
CD70 Primary immunodeficiency AR 4
CD79A Agammaglobulinemia 3 AR 3 7
CD79B Agammaglobulinemia 6 AR 2 3
CD81 Immunodeficiency, common variable, 6 AR 1 1
CD8A CD8 deficiency AR 1 1
CDCA7 Immunodeficiency-centromeric instability-facial anomalies syndrome 3 AR 4 6
CEBPE Specific granule deficiency 1 AR 3 4
CECR1 Polyarteritis nodosa, ADA2 deficiency AR 15 50
CENPF Ciliary dyskinesia -Lethal Ciliopathy AR 13 8
CFB Complement factor B deficiency, Hemolytic uremic syndrome, atypical AD/AR 2 26
CFD Complement factor D deficiency AR 2 3
CFH* Hemolytic uremic syndrome, atypical, Complement factor H deficiency, Basal laminar drusen AD/AR 18 305
CFI Hemolytic uremic syndrome, atypical, Complement factor I deficiency AD/AR 10 143
CFP Properdin deficiency XL 5 17
CFTR Cystic fibrosis, Congenital bilateral absence of the vas deferens AD/AR 518 1803
CHD7 Isolated gonadotropin-releasing hormone deficiency, CHARGE syndrome AD 276 860
CIITA Bare lymphocyte syndrome AR 9 15
CLCN7 Osteopetrosis AD/AR 15 98
CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) AR 26 25
COLEC11 3MC syndrome AR 6 13
COPA Autoimmune interstitial lung, joint, and kidney disease AD 6 6
CORO1A#* Immunodeficiency AR 41 6
CR2 Common variable immunodeficiency AR 2 16
CSF2RA#* Surfactant metabolism dysfunction, pulmonary XL 2 17
CSF2RB Surfactant metabolism dysfunction, pulmonary, 5 AR 2 6
CSF3R Neutrophilia, hereditary AD 13 13
CTC1 Cerebroretinal microangiopathy with calcifications and cysts AR 21 33
CTLA4 Autoimmune lymphoproliferative syndrome, type V AD 11 34
CTPS1 Immunodeficiency 24 AR 1 1
CTSC Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome AR 19 92
CXCR4 Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome AD 5 15
CYBA Chronic granulomatous disease AR 13 71
CYBB Chronic granulomatous disease, Immunodeficiency XL 69 780
DBR1 Immunodeficiency AR 1
DCLRE1C* Omenn syndrome, Severe combined immunodeficiency with sensitivity to ionizing radiation AR 18 89
DDX58 Singleton-Merten syndrome AD 4 3
DGKE Nephrotic syndrome AR 17 38
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
DNAAF1 Ciliary dyskinesia AR 19 38
DNAAF2 Ciliary dyskinesia AR 13 6
DNAAF3 Primary ciliary dyskinesia AD/AR 11 5
DNAAF5 Ciliary dyskinesia AR 9 5
DNAH1 Spermatogenic failure 18 AR 15 32
DNAH11* Ciliary dyskinesia AR 66 130
DNAH5 Ciliary dyskinesia AR 140 197
DNAH9 Primary ciliary dyskinesia AR 6
DNAI1 Ciliary dyskinesia AR 17 35
DNAI2 Ciliary dyskinesia AR 19 6
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNAL1 Ciliary dyskinesia AR 3 1
DNASE2 Primary immunodeficiency 2
DNMT3B Immunodeficiency-centromeric instability-facial anomalies syndrome AR 14 47
DOCK2 Immunodeficiency AR 7 6
DOCK8 Hyper-IgE recurrent infection syndrome, Mental retardation, autosomal dominant 2 AR 54 168
DRC1 Primary ciliary dyskinesia AD/AR 5 3
DYX1C1 Ciliary dyskinesia AR 15 12
EFL1* Shwachman-Diamond syndrome 3 2
ELANE Neutropenia AD 43 217
EPG5 Vici syndrome AR 36 66
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
EXTL3 Immunoskeletal dysplasia with neurodevelopmental abnormalities (ISDNA) AR 4 8
FADD Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations AR 2 1
FAS Autoimmune lymphoproliferative syndrome AD/AR 31 133
FASLG Autoimmune lymphoproliferative syndrome, type IB AD 2 10
FCHO1 Common variable immunodeficiency AR
FERMT3 Leukocyte adhesion deficiency AR 8 14
FOXN1 T-cell immunodeficiency, congenital alopecia, and nail dystrophy AR 6 6
FOXP3 Immunodysregulation, polyendocrinopathy, and enteropathy XL 28 93
G6PC3 Neutropenia, severe congenital, Dursun syndrome AR 11 37
G6PD Glucose-6-phosphate dehydrogenase deficiency XL 45 226
GAS2L2 Primary ciliary dyskinesia AR 3
GAS8 Ciliary dyskinesia, primary, 33 AR 4 6
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GFI1 Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults AD 2 6
GINS1 Immunodeficiency AR 4 4
HAX1 Neutropenia, severe congenital AR 11 21
HELLS Immunodeficiency-centromeric instability-facial anomalies syndrome 4 AR 6 6
HYDIN#* Primary ciliary dyskinesia AD/AR 5 25
HYOU1 Combined immunodeficiency AR 2
ICOS Immunodeficiency, common variable, 1 AR 3 4
IFIH1 Singleton-Merten syndrome, Aicardi-Goutieres syndrome 7 AD/AR 14 19
IFNAR2 Immunodeficiency 45 AR 1 2
IFNGR1 Immunodeficiency AD/AR 16 42
IFNGR2 Immunodeficiency AR 4 18
IGLL1* Agammaglobulinemia AR 2 3
IKBKB Immunodeficiency 15 AR 2 7
IKZF1 Immunodeficiency, common variable, 13 AD 10 35
IL10 Graft vs. host disease AD 1 5
IL10RA Inflammatory bowel disease AR 4 43
IL10RB Inflammatory bowel disease AR 2 19
IL12B Immunodeficiency 28, Immunodeficiency 29 AR 4 13
IL12RB1# Immunodeficiency AR 13 82
IL17RA Immunodeficiency 51 AR 8 17
IL17RC Candiasis, familial, 9 AR 3 4
IL1RN Osteomyelitis, sterile multifocal, with periostitis and pustulosis AR 6 12
IL21 Immunodeficiency, common variable, 11 AR 1 1
IL21R Immunodeficiency, primary, autosomal recessive, IL21R-related AR 3 9
IL23R Primary immunodeficiency AR 1
IL2RA Interleukin 2 receptor, alpha, deficiency AR 6 6
IL2RB Primary immunodeficiency AR
IL2RG Combined immunodeficiency XL 54 243
IL36RN Pustular psoriasis, generalized AR 6 26
IL6ST* Primary immunodeficiency AR
IL7R Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive AR 23 48
INVS Nephronophthisis AR 16 34
IRAK4 IRAK4 deficiency, Invasive pneumococcal disease, recurrent, isolated, 1 AR 12 29
IRF2BP2 Immunodeficiency, common variable, 14 AD 1 2
IRF8 Immunodeficiency 32A (CD11C-positive/CD1C-positive dendritic cell deficiency), Immunodeficiency 32B (monocyte and dendritic cell deficiency) AD/AR 4 8
ISG15 Immunodeficiency, with basal ganglia calcification AR 3 3
ITGB2 Leukocyte adhesion deficiency AR 33 118
ITK Lymphoproliferative syndrome AR 4 11
JAGN1 Neutropenia, severe congenital AR 8 8
JAK1 Primary immunodeficiency AR 4 6
JAK3 Severe combined immunodeficiency, , T cell-negative, B cell-positive, natural killer cell-negative AR 30 66
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LAMTOR2 Immunodeficiency due to defect in MAPBP-interacting protein AR 1 1
LAT Immunodeficiency 52 AR 2 18
LCK Immunodeficiency AR 2 3
LIG1 Primary immunodeficiency AR 3
LIG4 Severe combined immunodeficiency with sensitivity to ionizing radiation, LIG4 syndrome AR 18 36
LPIN2 Majeed syndrome AR 12 14
LRBA Common variable immunodeficiency AR 23 64
LRRC6 Ciliary dyskinesia AR 10 19
LYST Chediak-Higashi syndrome AR 50 97
MAGT1 Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 XL 8 14
MALT1 Immunodeficiency AR 3 5
MAP3K14 Primary immunodeficiency with multifaceted aberrant lymphoid immunity AR 1 2
MASP1 3MC syndrome AR 11 22
MCIDAS Primary ciliary dyskinesia AR 4 3
MEFV Familial Mediterranean fever AD/AR 29 182
MKL1 Primary immunodeficiency AR 4
MOGS Congenital disorder of glycosylation AR 7 8
MRE11A Ataxia-telangiectasia-like disorder-1 AR 57 56
MSN* Immunodeficiency 50 XL 2 2
MTHFD1 Severe combined immunodeficiency AR 9 11
MVK Mevalonic aciduria, Hyper-IgD syndrome, Porokeratosis 3, multiple types AD/AR 35 181
MYD88 MYD88 deficiency AR 5 5
MYO5A Griscelli syndrome AR 7 9
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 188 97
NCF1#* Chronic granulomatous disease AR 18 44
NCF2 Chronic granulomatous disease AR 19 72
NCF4 Granulomatous disease AR 4 5
NCSTN Acne inversa, familial 1 AD 7 30
NFKB1 Common variable immunodeficiency AD 8 17
NFKB2 Common variable immunodeficiency AD 6 11
NFKBIA Ectodermal dysplasia, anhidrotic, with T-cell immunodeficiency AD 5 11
NHEJ1 Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation AR 15 16
NHP2 Dyskeratosis congenita AR 5 3
NLRC4 Autoinflammation with infantile enterocolitis (AIFEC), Familial cold autoinflammatory syndrome 4 AD 6 8
NLRP1 Palmoplantar carcinoma, multiple self-healing, Autoinflammation with arthritis and dyskeratosis AD/AR 5 15
NLRP12 Familial cold autoinflammatory syndrome AD 12 12
NLRP3 Neonatal onset multisystem inflammatory disease (NOMID), Muckle-Wells syndrome, Chronic infantile neurologic cutaneous articular (CINCA) syndrome, Familial cold-induced autoinflammatory syndrome 1 AD 20 136
NME8 Ciliary dyskinesia AR 1 6
NOD2 Blau syndrome, Sarcoidosis, early-onset AD/AR 12 70
NOP10 Dyskeratosis congenita AR 1 1
NRAS Noonan syndrome AD 31 14
NSMCE3 Lung disease, immunodeficiency, and chromosome breakage syndrome (LICS) AR 2 2
OFD1 Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, Orofaciodigital syndrome, Joubert syndrome XL 153 160
ORAI1 Immunodeficiency, Myopathy, tubular aggregate, 2 AR 9 13
OTULIN Autoinflammation, panniculitis, and dermatosis syndrome (AIPDS) AR 8 3
PARN* Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 15 29
PEPD Prolidase deficiency AR 12 31
PGM3 Immunodeficiency 23 AR 14 15
PIGA* Multiple congenital anomalies-hypotonia-seizures syndrome XL 24 27
PIH1D3 Ciliary dyskinesia, primary, 36 XL 2 12
PIK3CD* Immunodeficiency AD 6 12
PIK3R1 Agammaglobulinemia, SHORT syndrome AD/AR 33 24
PLCG2 Familial cold autoinflammatory syndrome 3 (PLAID), Autoinflammation, antibody deficiency, and immune dysregulation syndrome (APLAID) AD 7 13
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
PNP Purine nucleoside phosphorylase deficiency AR 11 33
POLD1 Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency AD/AR 3 31
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 70
POLE2 Combined immunodeficiency AR 3
POMP Keratosis linearis with ichthyosis congenita and sclerosing keratoderma AR 5 4
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PRG4 Camptodactyly-arthropathy-coxa vara-pericarditis syndrome AR 6 35
PRKCD Autoimmune lymphoproliferative syndrome type III AR 4 6
PRKDC Immunodeficiency AR 6 9
PSENEN Acne inversa, familial, 2 AD 7 17
PSMB8 Nakajo-Nishimura syndrome, Chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature syndrome, Autoinflammation, lipodystrophy, and dermatosis syndrome, Joint contractures, muscular atrophy, microcytic anemia, and panniculitis-induced lipodystrophy syndrome AR 5 9
PSTPIP1 Pyogenic sterile arthritis, pyoderma gangrenosum, and acne AD 5 29
PTPRC Severe combined immunodeficiency, , T-cell negative, B-cell positive, NK cell positive AR 4 5
RAB27A Griscelli syndrome, Elejalde syndrome AR 18 54
RAC2 Neutrophil immunodeficiency syndrome AD 2 3
RAG1 Omenn syndrome, Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity, T cell-negative, B cell-negative, natural killer cell-positive severe combined immunodeficiency, Combined cellular and humoral immune defects with granulomas AR 47 184
RAG2 Omenn syndrome, Combined cellular and humoral immune defects with granulomas AR 28 79
RASGRP1 Primary immunodeficiency AR 1 3
RBCK1 Polyglucosan body myopathy AR 11 14
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
RELA* Autoimmune lymphoproliferative syndrome AD 1 3
RFX5 Bare lymphocyte syndrome AR 4 10
RFXANK MHC class II deficiency AR 8 16
RFXAP Bare lymphocyte syndrome AR 6 9
RHOH T-cell immunodeficiency with epidermodysplasia verruciformis AD/AR 1
RIPK1 Primary immunodeficiency AR 3 1
RLTPR Combined immunodeficiency AR 11 8
RMRP Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia AR 87 123
RNASEH2A Aicardi-Goutières syndrome AR 13 21
RNASEH2B Aicardi-Goutières syndrome AR 16 41
RNASEH2C Aicardi-Goutières syndrome AR 6 14
RNF168 RIDDLE syndrome AR 4 5
RNF31 HOIP and LUBAC deficiency AR 1
RNU4ATAC Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3 AR 15 24
RORC Immunodeficiency 42 AR 3 3
RPGR Retinitis pigmentosa, Cone-rod dystrophy, X-linked, 1, Macular degeneration, X-linked atrophic, Retinitis pigmentosa 3 XL 79 218
RPSA Asplenia, isolated congenital AD 7 8
RSPH1 Ciliary dyskinesia AR 14 10
RSPH3 Ciliary dyskinesia, primary, 32 AR 7 5
RSPH4A Ciliary dyskinesia AR 18 24
RSPH9 Ciliary dyskinesia AR 8 12
RTEL1 Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 58 51
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SAMHD1 Aicardi-Goutières syndrome, Chilblain lupus 2 AD/AR 25 56
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AD/AR 19 90
SERPING1 Angioedema, Complement component 4, partial deficiency of AD/AR 34 563
SH2D1A Lymphoproliferative syndrome XL 21 129
SLC29A3 Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis AR 17 25
SLC35C1 Congenital disorder of glycosylation, Leukocyte adhesion deficiency AR 6 7
SLC37A4 Glycogen storage disease AR 49 113
SLC39A7 Agammaglobulinemia AR
SLC46A1 Folate malabsorption AR 17 23
SLC7A7 Lysinuric protein intolerance AR 55 67
SMARCAL1 Schimke immunoosseous dysplasia AR 20 88
SMARCD2 Specific granule defiency 2 AR 3 1
SP110 Hepatic venoocclusive disease with immunodeficiency AR 8 8
SPAG1 Primary ciliary dyskinesia AR 18 11
SPINK5 Netherton syndrome AR 29 85
SPPL2A Primary immunodeficiency AR 1
SRP54 Shwachman-Diamond syndrome AD 3
SRP72* Bone marrow failure syndrome 1 AD 2 5
STAT1 Immunodeficiency AD/AR 39 122
STAT2 Immunodeficiency AR 3 6
STAT3 Hyper-IgE recurrent infection syndrome, Autoimmune disease, multisystem, infantile onset AD 47 152
STAT5B* Growth hormone insensitivity with immunodeficiency AR 9 13
STIM1 Stormorken syndrome, Immunodeficiency, Myopathy, tubular aggregate 1 AD/AR 13 24
STK36 Primary ciliary dyskinesia AR 5
STK4 T-cell immunodeficiency syndrome, recurrent infections, autoimmunity, AR 3 7
STX11 Hemophagocytic lymphohistiocytosis, familial AR 8 22
STXBP2 Hemophagocytic lymphohistiocytosis, familial AR 12 77
TAP1 Bare lymphocyte syndrome AR 1 7
TAP2 Bare lymphocyte syndrome AR 4 8
TAPBP Bare lymphocyte syndrome AR 1 2
TBX1 Conotruncal anomaly face syndrome AD 17 72
TCF3 Agammaglobulinemia 8, autosomal dominant AD 1 5
TCN2 Transcobalamin II deficiency AR 9 35
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
TFRC Immunodeficiency 46 AR 8 2
TGFB1 Diaphyseal dysplasia Camurati-Engelmann AD 15 23
THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical AD 5 28
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TMC6 Epidermodysplasia verruciformis AR 8 7
TMC8 Epidermodysplasia verruciformis AR 3 9
TMEM173 STING-associated vasculopathy, infantile-onsent (SAVI) AD 4 10
TNFAIP3 Autoinflammatory syndrome, familial, Behcet-like AD 8 23
TNFRSF13B Common variable immunodeficiency, Immunoglobulin A deficiency AD/AR 7 48
TNFRSF1A# Periodic fever (TNF receptor-associated periodic syndrome) AD 19 106
TNFRSF4 Immunodeficiency AR 1 1
TRAF3IP2 Candidiasis, familial 8 AR 1 3
TREX1 Vasculopathy, retinal, with cerebral leukodystrophy, Chilblain lupus, Aicardi-Goutières syndrome AD/AR 30 71
TRNT1 Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay AR 13 26
TTC37 Trichohepatoenteric syndrome, Primary immunodeficiency AR 12 64
TTC7A Gastrointestinal defects and immunodeficiency syndrome AR 21 46
TYK2 Immunodeficiency AR 9 9
UNC119 Immunodeficiency, Cone-rod dystrophy 2 AR 1 5
UNC13D Hemophagocytic lymphohistiocytosis, familial AR 22 192
UNC93B1* Herpes simplex encephalitis, susceptibility to, 1 AR 2
UNG Immunodeficiency with hyper-IgM, type 5 AR 6 7
USB1 Poikiloderma with neutropenia AR 24 22
USP18#* Pseudo-TORCH syndrome 2 AR 40 1
VPS13B Cohen syndrome AR 351 203
VPS45# Neutropenia, severe congenital, 5, autosomal recessive AR 3 4
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome XL 57 439
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3
WRAP53 Dyskeratosis congenita AR 7 6
XIAP* Lymphoproliferative syndrome XL 14 96
ZAP70 Selective T-cell defect AR 15 29
ZBTB24 Immunodeficiency-Centromeric Instability-Facial Anomalies 2 AR 7 17
ZMYND10 Ciliary dyskinesia AR 8 16
ZNF341* AR 5

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by Primary Immunodeficiency (PID) and Primary Ciliary Dyskinesia (PCD) Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
ADA Chr20:43248503 c.1079-15T>A NM_000022.2 rs387906268
ADA Chr20:43249076 c.976-34G>A NM_000022.2
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BTK ChrX:100609705 c.1567-23A>C/G NM_000061.2
BTK ChrX:100609705 c.1567-23A>G NM_000061.2
BTK ChrX:100609705 c.1567-23A>C NM_000061.2
BTK ChrX:100612468 c.1177+28_1177+29insAGAAAAAAGGT NM_000061.2
BTK ChrX:100613695 c.895-11C>A NM_000061.2
BTK ChrX:100625094 c.310-28_310-27delGCinsTG NM_000061.2
BTK ChrX:100629415 c.240+109C>A NM_000061.2
BTK ChrX:100629416 c.240+108T>G NM_000061.2
BTK ChrX:100629827 c.142-205A>G NM_000061.2
BTK ChrX:100630121 c.141+11C>T NM_000061.2 rs138411530
BTK ChrX:100641044 c.-31+6T>G NM_000061.2
BTK ChrX:100641045 c.-31+5G>A/C/T NM_000061.2
BTK ChrX:100641045 c.-31+5G>A NM_000061.2
BTK ChrX:100641045 c.-31+5G>T NM_000061.2 rs1131691354
BTK ChrX:100641045 c.-31+5G>C NM_000061.2
BTK ChrX:100641049 c.-31+1G>A/C NM_000061.2
BTK ChrX:100641049 c.-31+1G>A NM_000061.2
BTK ChrX:100641049 c.-31+1G>C NM_000061.2
BTK ChrX:100641050 c.-31G>A NM_000061.2
BTK ChrX:100641212 c.-193A>G NM_000061.2
C1QB Chr1:22985931 c.-17-2A>C NM_000491.3
CCDC39 Chr3:180365042 c.1363-11A>G NM_181426.1
CCDC39 Chr3:180367928 c.1167+1261A>G NM_181426.1 rs577069249
CCDC39 Chr3:180367941 c.1167+1248A>G NM_181426.1
CD40LG ChrX:135736498 c.289-32_289-25delAAAATGAC NM_000074.2
CD40LG ChrX:135736517 c.289-15T>A NM_000074.2
CD40LG ChrX:135737600 c.347-915A>T NM_000074.2
CD46 Chr1:207930564 c.286+27delT NM_002389.4 rs771669828
CECR1 Chr22:17664763 c.1082-1113delA NM_017424.2
CFTR Chr7:117119654 c.-495C>T NM_000492.3 rs397507565
CFTR Chr7:117119797 NM_000492.3
CFTR Chr7:117119900 c.-249G>C NM_000492.3
CFTR Chr7:117119984 c.-165G>A NM_000492.3 rs145483167
CFTR Chr7:117120064 c.-85C>G NM_000492.3
CFTR Chr7:117120115 c.-34C>T NM_000492.3 rs756314710
CFTR Chr7:117120325 c.53+124T>C NM_000492.3
CFTR Chr7:117179040 c.870-1113_870-1110delGAAT NM_000492.3 rs397508809
CFTR Chr7:117182041 c.1117-26_1117-25delAT NM_000492.3 rs397508159
CFTR Chr7:117199500 c.1393-18G>A NM_000492.3 rs397508199
CFTR Chr7:117218381 c.1585-9412A>G NM_000492.3 rs397508229
CFTR Chr7:117227774 c.1585-19T>C NM_000492.3 rs778457306
CFTR Chr7:117227921 c.1679+34G>T NM_000492.3 rs767901668
CFTR Chr7:117229521 c.1680-886A>G NM_000492.3 rs397508266
CFTR Chr7:117229524 c.1680-883A>G NM_000492.3
CFTR Chr7:117229530 c.1680-877G>T NM_000492.3 rs397508261
CFTR Chr7:117243855 c.2908+19G>C NM_000492.3 rs370683572
CFTR Chr7:117246713 c.2909-15T>G NM_000492.3 rs397508455
CFTR Chr7:117246840 c.2988+33G>T NM_000492.3
CFTR Chr7:117251609 c.3140-26A>G NM_000492.3 rs76151804
CFTR Chr7:117251619 c.3140-16T>A NM_000492.3 rs767232138
CFTR Chr7:117251624 c.3140-11A>G NM_000492.3
CFTR Chr7:117266272 c.3469-1304C>G NM_000492.3
CFTR Chr7:117267864 c.3717+40A>G NM_000492.3 rs397508595
CFTR Chr7:117280015 c.3718-2477C>T NM_000492.3 rs75039782
CFTR Chr7:117282680 c.3873+33A>G NM_000492.3 rs397508622
CFTR Chr7:117288374 c.3874-4522A>G NM_000492.3
CFTR Chr7:117308395 c.*1233T>A NM_000492.3
CHD7 Chr8:61734568 c.2836-15C>G NM_017780.3
CHD7 Chr8:61757794 c.5051-15T>A NM_017780.3
CHD7 Chr8:61763034 c.5405-18C>A NM_017780.3 rs199981784
CHD7 Chr8:61763039 c.5405-13G>A NM_017780.3 rs1131690787
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
CTSC Chr11:88070895 c.-55C>A NM_001814.4 rs766114323
CYBA Chr16:88712620 c.288-15C>G NM_000101.3
CYBB ChrX:37639262 c.-69A>C NM_000397.3
CYBB ChrX:37639262 NM_000397.3
CYBB ChrX:37639264 c.-67T>C NM_000397.3
CYBB ChrX:37639266 c.-65C>T NM_000397.3
CYBB ChrX:37639267 c.-64C>T NM_000397.3
CYBB ChrX:37641327 c.46-14_46-11delTTCTinsGAA NM_000397.3
CYBB ChrX:37641330 c.46-11T>G NM_000397.3
CYBB ChrX:37642713 c.142-28_142-12delACTCTGCTCCCTTTCCC NM_000397.3
CYBB ChrX:37642731 c.142-12delCinsACCTCTTCTAG NM_000397.3
CYBB ChrX:37654041 c.483+978G>T NM_000397.3
CYBB ChrX:37656474 c.674+1080A>G NM_000397.3
CYBB ChrX:37656731 c.674+1337T>G NM_000397.3
CYBB ChrX:37657051 c.675-1157A>G NM_000397.3
CYBB ChrX:37664248 c.1152-11T>G NM_000397.3
DGKE Chr17:54925466 c.888+40A>G NM_003647.2
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
DNMT3B Chr20:31395557 c.2421-11G>A NM_006892.3 rs547940069
DOCK8 Chr9:317025 c.742-18C>G NM_203447.3 rs112373444
DOCK8 Chr9:317028 c.742-15T>G NM_203447.3 rs111627162
DOCK8 Chr9:368196 c.1797+61A>C NM_203447.3 rs786205596
FAS Chr10:90770494 c.506-16A>G NM_000043.4
FASLG Chr1:172628081 c.-261T>C NM_000639.1
FOXP3 ChrX:49106917 c.*878A>G NM_014009.3
FOXP3 ChrX:49106919 c.*876A>G NM_014009.3
FOXP3 ChrX:49121118 c.-23+5G>A NM_014009.3
FOXP3 ChrX:49121121 c.-23+2T>G NM_014009.3
FOXP3 ChrX:49121122 c.-23+1G>A NM_014009.3
FOXP3 ChrX:49121122 c.-23+1G>T NM_014009.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GINS1 Chr20:25388397 c.-60A>G NM_021067.3
GINS1 Chr20:25388409 c.-48C>G NM_021067.3
IL10RB Chr21:34668714 c.*52C>T NM_000628.4
IL2RG ChrX:70327277 c.*307_*308delAA NM_000206.2
IL2RG ChrX:70327278 c.*308A>G NM_000206.2
IL2RG ChrX:70330553 c.270-15A>G NM_000206.2
IL2RG ChrX:70331494 c.-105C>T NM_000206.2
IL7R Chr5:35867853 c.379+288G>A NM_002185.3
IRAK4 Chr12:44178047 c.1188+520A>G NM_016123.3
ITGB2 Chr21:46320404 c.742-14C>A NM_000211.3 rs183204825
ITGB2 Chr21:46321660 c.500-12T>G NM_000211.3
JAK3 Chr19:17943239 c.2680+89G>A NM_000215.3
JAK3 Chr19:17946035 c.1915-11G>A NM_000215.3
LAMTOR2 Chr1:156028185 c.*23C>A NM_014017.3
MEFV Chr16:3306599 c.-12C>G NM_000243.2 rs104895148
MEFV Chr16:3306969 c.-382C>G NM_000243.2
MVK Chr12:110029032 c.769-7dupT NM_000431.2 rs104895348
OFD1 ChrX:13768358 c.935+706A>G NM_003611.2 rs730880283
OFD1 ChrX:13773245 c.1130-22_1130-19delAATT NM_003611.2 rs312262865
OFD1 ChrX:13773249 c.1130-20_1130-16delTTGGT NM_003611.2
PARN Chr16:14724045 c.-165+2C>T NM_001134477.2
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PNP Chr14:20942914 c.286-18G>A NM_000270.3
POLE Chr12:133249181 c.1686+32C>G NM_006231.2 rs762985435
POMP Chr13:29233225 c.-95delC NM_015932.5 rs112368783
PSENEN Chr19:36236501 c.-192_-190delAGA NM_172341.2 rs554724520
RAG2 Chr11:36619652 c.-28G>C NM_000536.3
RFXANK Chr19:19307761 c.188-11C>T NM_003721.3 rs201545133
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
RNASEH2B Chr13:51501530 c.65-13G>A NM_024570.3
RNASEH2B Chr13:51519550 c.511-13G>A NM_024570.3
RPGR ChrX:38128234 NM_000328.2
RPGR ChrX:38160137 c.1059+363G>A NM_001034853.1
RPSA Chr3:39448260 c.-34+5G>C NM_002295.4
SERPING1 Chr11:57365055 c.-163C>T NM_000062.2
SERPING1 Chr11:57365057 c.-161A>G NM_000062.2
SERPING1 Chr11:57365118 c.-100C>G NM_000062.2 rs578018379
SERPING1 Chr11:57365720 c.-22-2A>C/G NM_000062.2
SERPING1 Chr11:57365720 c.-22-2A>C NM_000062.2
SERPING1 Chr11:57365720 c.-22-2A>G NM_000062.2
SERPING1 Chr11:57365721 c.-22-1G>A NM_000062.2
SERPING1 Chr11:57373471 c.686-12A>G NM_000062.2
SERPING1 Chr11:57373867 c.890-14C>G NM_000062.2
SERPING1 Chr11:57381788 c.1250-13G>A NM_000062.2
SH2D1A ChrX:123499593 c.138-17_138-11delAGTTTAT NM_002351.4
SLC29A3 Chr10:73122778 c.*413G>A NM_018344.5
SPINK5 Chr5:147465956 c.283-12T>A NM_006846.3
SPINK5 Chr5:147484503 c.1431-12G>A NM_006846.3 rs368134354
SPINK5 Chr5:147491511 c.1820+53G>A NM_006846.3 rs754599628
STX11 Chr6:144508713 c.*85_*86insT NM_003764.3
STXBP2 Chr19:7705761 c.326-23_326-16delGCCCCACT NM_006949.3
TBX1 Chr22:19743578 c.-777C>T NM_080647.1
TBX1 Chr22:19743735 c.-620A>C NM_080647.1 rs536892777
TCN2 Chr22:31011112 c.581-176A>T NM_000355.3
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
THBD Chr20:23030319 NM_000361.2
THBD Chr20:23030443 c.-302C>A NM_000361.2
TRNT1 Chr3:3188088 c.609-26T>C NM_182916.2
UNC13D Chr17:73826245 c.2831-13G>A NM_199242.2
UNC13D Chr17:73827442 c.2448-13G>A NM_199242.2 rs753762300
UNC13D Chr17:73839907 c.118-307G>A NM_199242.2
UNC13D Chr17:73839908 c.118-308C>T NM_199242.2
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2
ZAP70 Chr2:98349927 c.838-80G>A NM_001079.3 rs113994173
ZAP70 Chr2:98354447 c.1624-11G>A NM_001079.3 rs730880318

Added and removed genes from the panel

Genes added Genes removed

Test Strengths

The strengths of this test include:
  • CAP and ISO-15189 accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ARMC4 (NM_018076:9;NM_001290021:13), CD55 (NM_001114752:10;NM_001300903:10), CORO1A (NM_007074:11), CSF2RA (NM_001161530:9), HYDIN (NM_001270974:6,8,12,18,20,21,23,26,27,31,35,37,45,47,50,52,57,58,64,70,75,78,82,83), IL12RB1 (NM_153701:10), NCF1 (NM_000265:1,5,8,9,11), TNFRSF1A (NM_001346092:6), USP18 (NM_017414:11), VPS45 (NM_001279353:13). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics primary immunodeficiency (PID) and primary ciliary dyskinesia (PCD) panel covers classical genes associated with autoinflammatory disorders, combined immunodeficiencies, congenital defects of phagocytes, cystic fibrosis, defects in innate immunity, diseases of immune dysregulation, immunodeficiencies with antibody defects, infertility, other specified congenital malformations of respiratory system, primary ciliary dyskinesia and situs inversus. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient’s phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999
Insertions, deletions and indels by sequence analysis
1-10 bps 96.9% (7,563/7,806) >99.9999
11-50 bps 99.13% (2,524/2,546) >99.9999
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
The performance presented above reached by WES with the following coverage metrics
Mean sequencing depth at exome level 143X
Nucleotides with >20x sequencing coverage (%) 99.86%


The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis is orthogonal confirmation. Sequence variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing when they do not meet our stringent NGS quality metrics for a true positive call.
Reported heterozygous and homo/hemizygous copy number variations with a size <10 and <3 target exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen and confirmed less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.


Subscribe to our newsletter