Hereditary Pancreatic Cancer Core Panel
Is ideal for patients with a clinical suspicion of hereditary pancreatic cancer susceptibility. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.
- PLUS
Summary
The Blueprint Genetics Hereditary Pancreatic Cancer Core Panel (test code ON2001):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
ICD Codes
Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
Pancreatic ductal carcinoma makes up the vast majority (90%) of all pancreatic neoplasms, and remains a disease with very poor prognosis and high morbidity. Familial aggregation has been recognized in approximately 10% of pancreatic cancers. Familial pancreatic cancer is defined as a family with at least one pair of first-degree relatives (parent-child or sibling pair) with pancreatic cancer without an identifiable syndrome in the family. Inherited pancreatic cancer is genetically highly heterogenous and has been associated with germline mutations in BRCA1, BRCA2, CDKN2A, PALB2 and STK11.
Genes in the Hereditary Pancreatic Cancer Core Panel and their clinical significance
To view complete table content, scroll horizontally.
| Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
|---|---|---|---|---|
| BRCA1* | Pancreatic cancer, Breast-ovarian cancer, familial, Fanconi anemia | AD/AR | 2997 | 2631 |
| BRCA2 | Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial | AD/AR | 3369 | 2659 |
| CDKN2A | Melanoma, familial, Melanoma-pancreatic cancer syndrome | AD | 87 | 232 |
| PALB2 | Fanconi anemia, Pancreatic cancer, Breast cancer | AD/AR | 495 | 406 |
| STK11 | Peutz-Jeghers syndrome | AD | 173 | 460 |
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Hereditary Pancreatic Cancer Core Panel
To view complete table content, scroll horizontally.
| Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
|---|---|---|---|---|
| BRCA1 | Chr17:41196352 | c.*1340_*1342delTGT | NM_007294.3 | rs1281551853 |
| BRCA1 | Chr17:41196424 | c.*1271T>C | NM_007294.3 | |
| BRCA1 | Chr17:41197167 | c.*528G>C | NM_007294.3 | rs1060504556 |
| BRCA1 | Chr17:41197588 | c.*103_*106delTGTC | NM_007294.3 | rs431825382 |
| BRCA1 | Chr17:41197637 | c.*58C>T | NM_007294.3 | rs137892861 |
| BRCA1 | Chr17:41197859 | c.5468-40T>A | NM_007294.3 | rs80358151 |
| BRCA1 | Chr17:41199745 | c.5407-25T>A | NM_007294.3 | rs758780152 |
| BRCA1 | Chr17:41201232 | c.5333-36_5333-22delTACTGCAGTGATTTT | NM_007294.3 | |
| BRCA1 | Chr17:41206122 | c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG | NM_007294.3 | |
| BRCA1 | Chr17:41209164 | c.5194-12G>A | NM_007294.3 | rs80358079 |
| BRCA1 | Chr17:41215994 | c.5075-27delA | NM_007294.3 | |
| BRCA1 | Chr17:41251909 | c.442-22_442-13delTGTTCTTTAC | NM_007294.3 | rs879254224 |
| BRCA1 | Chr17:41256984 | c.213-11T>G | NM_007294.3 | rs80358061 |
| BRCA1 | Chr17:41256985 | c.213-12A>G | NM_007294.3 | rs80358163 |
| BRCA1 | Chr17:41256988 | c.213-15A>G | NM_007294.3 | |
| BRCA1 | Chr17:41276134 | c.-19-2A>G | NM_007294.3 | |
| BRCA2 | Chr13:32889805 | c.-40+1G>A | NM_000059.3 | |
| BRCA2 | Chr13:32890469 | c.-39-89delC | NM_000059.3 | |
| BRCA2 | Chr13:32890556 | c.-39-1_-39delGA | NM_000059.3 | rs758732038 |
| BRCA2 | Chr13:32890558 | c.-39-1G>A | NM_000059.3 | rs1060499566 |
| BRCA2 | Chr13:32900222 | c.426-12_426-8delGTTTT | NM_000059.3 | rs276174844 |
| BRCA2 | Chr13:32945079 | c.8488-14A>G | NM_000059.3 | |
| BRCA2 | Chr13:32953872 | c.8954-15T>G | NM_000059.3 | |
| BRCA2 | Chr13:32971007 | c.9502-28A>G | NM_000059.3 | rs397508059 |
| BRCA2 | Chr13:32971023 | c.9502-12T>G | NM_000059.3 | rs81002803 |
| CDKN2A | Chr9:21968346 | c.458-105A>G | NM_000077.4 | |
| CDKN2A | Chr9:21973573 | c.150+1104C>A | NM_000077.4 | rs756102261 |
| CDKN2A | Chr9:21974401 | c.*73+2T>G | NM_058197.4 | |
| CDKN2A | Chr9:21974847 | c.-21C>T | NM_000077.4 | |
| CDKN2A | Chr9:21974875 | c.-49C>A | NM_000077.4 | rs1064797383 |
| CDKN2A | Chr9:21974882 | c.-56G>T | NM_000077.4 | |
| CDKN2A | Chr9:21974916 | c.-93_-91delAGG | NM_000077.4 | |
| PALB2 | Chr16:23649285 | c.109-12T>A | NM_024675.3 | rs774949203 |
| STK11 | Chr19:1220520 | c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG | NM_000455.4 | |
| STK11 | Chr19:1220530 | c.598-32_597+31delGCCCCCTCCCGGGC | NM_000455.4 |
Test Strengths
The strengths of this test include:
- CAP accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
- Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
- ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
The genes on the panels have been carefully selected based on scientific literature, mutation databases, and our experience.
The panels are sectioned from our high-quality, clinical grade NGS assay. The panel analysis includes a combination of both sequence variants (single nucleotide variants (SNV’s) and indels) as well as deletions and duplications (copy number variants (CNV)).
Please refer to the table below for performance metrics of the analytical validation of the assay. The validation includes the evaluation of reference samples to determine the capability of the assay to detect various types of variants. The sensitivity values quoted in the analytic validation may not precisely reflect the performance in a production setting and is not a guarantee of the assay’s clinical performance. The provided performance metrics are based on a validation conducted at our laboratory in Finland. The assay has been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva, and dried blood spots (filter paper cards).
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Analytical sensitivity to detect single-nucleotide variants and indels were calculated using both versions v3.3.2 and v4.2.1 of high-confidence region benchmark data provided by Genome in a Bottle (GIAB) consortium. Version 4.2.1 is extended to include challenging medically relevant regions and other difficult to map regions. Version 4.2.1 covers 94.1% of reference (GRCh37) and v3.3.2 covers 87.8% of reference. For more information, see GIAB publication https://doi.org/10.1016/j.xgen.2022.100128.
| Sensitivity % (TP/(TP+FN) | Specificity % | |||
|---|---|---|---|---|
| GIAB Version 3.3.2 | GIAB Version 4.2.1 | GIAB Version 3.3.2 | GIAB Version 4.2.1 | |
| Single nucleotide variants | 99.57 % | 97.58 % | 100 % | 100 % |
| Insertions, deletions | ||||
| 1-10 bps | 95.38 % | 95.13 % | 100.00 % | 100.00 % |
| 11-20 bps | 99.09 % | 98.15 % | 100.00 % | 100.00 % |
| 21-50 bps | 98.78 % | 98.85 % | 100.00 % | 100.00 % |
| 2-50 bps | 97.62 % | 97.41 % | 100.00 % | 100.00 % |
| Copy number variants (exon level dels/dups, clinical sample performance) | Sensitivity | Specificity | ||
| 1 exon level deletion (heterozygous) | 100% (14/14) | NA | ||
| 1 exon deletion (homozygous or hemizygous) | 100% (5/5) | NA | ||
| 2-4 exon deletion (heterozygous or homozygous) | 100% (17/17) | NA | ||
| 5-33 exon deletion (heterozygous) | 100% (12/12) | NA | ||
| 1-5 exon duplication (heterozygous or homozygous) | 77% (10/13) | NA | ||
| 9-31 exon duplication (heterozygous) | 100% (7/7) | NA | ||
| Simulated CNV detection in reference samples (n=10) | Sensitivity | |||
| 5 exon level deletion/duplication | 98 % | |||
| Microdeletion/-duplication syndromes (large CNVs, n=22)) | ||||
| Size range (0.1-47 Mb) | 100% (22/22) | |||
| The performance presented above was reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||||
| Average of median sequencing depths in reference samples | 136x | |||
| Nucleotides with >20x sequencing coverage (%) | 99.77% | |||
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
| ANALYTIC VALIDATION (reference samples; n=4) | Sensitivity % | |||
| Single nucleotide variants | ||||
| Heteroplasmic (45-100%) | 100.0% (50/50) | |||
| Heteroplasmic (35-45%) | 100.0% (87/87) | |||
| Heteroplasmic (25-35%) | 100.0% (73/73) | |||
| Heteroplasmic (15-25%) | 100.0% (74/74) | |||
| Heteroplasmic (5-15%) | 100.0% (79/79) | |||
| Heteroplasmic (<5%) | 53.3 % (8/15) | |||
| CLINICAL VALIDATION (n=20 samples) | ||||
| Single nucleotide variants (n=18 SNVs) | 100.0% (3/3) | |||
| Heteroplasmic (10-15%) | 100.0% (5/5) | |||
| Heteroplasmic (5-10%) | 100.0% (5/5) | |||
| Heteroplasmic (<5%) | 20% (1/5) | |||
| Insertions and deletions by sequence analysis (n=3) | ||||
| Heteroplasmic (45-100%) 1-10bp | 100.0% (3/3) | |||
| Validation of the mitochondrial genome analysis workflow (based on simulated data of pathogenic mitomap mutations) | ||||
| Insertions and deletions 1-24 bps by sequence analysis; n=17 | ||||
| Homoplasmic (100%) 1-24bp | 100.0% (17/17) | |||
| Heteroplasmic (50%) | 100.0% (17/17) | |||
| Heteroplasmic (25%) | 100.0% (17/17) | |||
| Heteroplasmic (20%) | 100.0% (17/17) | |||
| Heteroplasmic (15%) | 100.0% (17/17) | |||
| Heteroplasmic (10%) | 94.1% (16/17) | |||
| Heteroplasmic (5%) | 94.1% (16/17) | |||
| Copy number variants (separate artifical mutations; n=1500) | ||||
| Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | |||
| Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | |||
| Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | |||
| Following mtDNA coverage metrics were obtained in clinical samples in the assay validation (n=238) | ||||
| Mean of medians | ||||
| Mean sequencing depth MQ0 | 6334x | |||
| Nucleotides with >1000x MQ0 sequencing coverage (%) | 100% | |||
| rho zero cell line (=no mtDNA), mean sequencing depth in mitochondrial assay validation | 12X | |||
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.
Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.
Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.
Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.
Other
- Becker, AE.et al. Pancreatic ductal adenocarcinoma: risk factors, screening, and early detection. World J Gastroenterol. 2014 Aug 28;20(32):11182-98.
- Bright Pink
- Cancer.Net - Familial Pancreatic Cancer
- Cancer.Net - Peutz-Jeghers Syndrome
- GeneReviews - *BRCA1* and *BRCA2* Hereditary Breast and Ovarian Cancer
- GeneReviews - Peutz-Jeghers Syndrome
- HBOC Society
- NORD - Peutz-Jeghers Syndrome
- PALB2Interest Group
- Pancare Foundation
- Pancreatic Cancer UK