Cystic Kidney Disease Panel

Summary
Is a 43 gene panel that includes assessment of non-coding variants.

Is ideal for patients with multicystic dysplastic kidneys with or without additional congenital anomalies.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
43
Test code
KI0901
Panel tier
Tier 2

Summary

The Blueprint Genetics Cystic Kidney Disease Panel (test code KI0901):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

Exons 1-33 of the *PKD1* have multiple segmentally duplicated pseudogenes that reduce sensitivity of NGS diagnostics in general. However, Blueprint Genetics custom assay has good coverage (>20x) with high mapping rates (mapping quality >40) for 99.5% of the target regions in *PKD1* gene. Our validation showed high mean coverage of 199X for the *PKD1* gene. Thus, our NGS Panel is not expected to have major limitations in detecting variants in *PKD1* gene although clinical validation has not been performed at large scale.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

In addition to polycystic kidney disease (PKD), the Cystic Kidney Disease Panel offers diagnostics for other multicystic dysplastic kidney disorders (MCDK), such as congenital anomalies with unilateral or bilateral kidney enlargement, distended by multiple cysts, and non-functional and medullary cystic kidney disease. MCDK frequently presents antenatally at routine ultrasound scans, with the majority detected around the 20th week of gestation. Most patients with unilateral MCDK are asymptomatic if the other kidney is fully functional but may occasionally present with abdominal obstructive signs when the cysts become too large. They may also develop hypertension, proteinuria, and renal failure in the long run. Hypertrophy of the contralateral kidney may occur in 24-46% cases before birth, and in up to 80% of cases in the years after birth. Bilateral MCDK is considered a lethal entity. At birth, affected infants have features of the Potter sequence (constellation of signs resulting from prolonged in utero oligohydramnios) with severe pulmonary hypoplasia and severe renal failure, and they often die shortly after birth. The global prevalence of MCDK is not known, but the birth prevalence of the unilateral MCDK is estimated at 1:4,300 live births.

Genes in the Cystic Kidney Disease Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ANKS6 Nephronophthisis AR 9 12
CEP164 Nephronophthisis AR 11 9
CEP290* Bardet-Biedl syndrome, Leber congenital amaurosis, Joubert syndrome, Senior-Loken syndrome, Meckel syndrome AR 130 289
CEP83 Nephronophthisis AR 10 10
COL4A1 Schizencephaly, Anterior segment dysgenesis with cerebral involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease AD 58 107
CRB2 Focal segmental glomerulosclerosis, Ventriculomegaly with cystic kidney disease AR 12 22
DCDC2 Deafness, Nephronophthisis, Sclerosing cholangitis, neonatal AR 13 9
DNAJB11 Autosomal dominant polycystic kidney disease AD 6 1
DZIP1L Polycystic kidney disease 5 AR 4 5
EYA1 Otofaciocervical syndrome, Branchiootic syndrome, Branchiootorenal syndrome AD 56 218
GANAB Polycystic kidney and/or polycystic liver disease 3 AD 7 12
GLIS2 Nephronophthisis AR 3 3
HNF1B Renal cell carcinoma, nonpapillary chromophobe, Renal cysts and diabetes syndrome AD 35 234
IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 22 25
INVS Nephronophthisis AR 16 34
IQCB1 Senior-Loken syndrome AR 24 41
JAG1 Alagille syndrome AD 131 610
LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis AD/AR/Digenic 57 196
MAPKBP1 Nephronophthisis 20 AR 6 7
NEK8 Nephronophthisis, Renal-hepatic-pancreatic dysplasia AD/AR 16 18
NOTCH2* Alagille syndrome, Hajdu-Cheney syndrome AD 37 70
NPHP1 Nephronophthisis, Joubert syndrome, Senior-Loken syndrome AR 19 76
NPHP3 Nephronophthisis, Renal-hepatic-pancreatic dysplasia, Meckel syndrome AR 38 75
NPHP4 Nephronophthisis, Senior-Loken syndrome AR 20 113
OFD1 Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, Orofaciodigital syndrome, Joubert syndrome XL 153 160
PAX2 Isolated renal hypoplasia, Papillorenal syndrome, Focal segmental glomerulosclerosis 7 AD 30 96
PKD1* Polycystic kidney disease 1 AD 237 1923
PKD2 Polycystic kidney disease 2 AD 55 333
PKHD1 Polycystic kidney disease AR 249 557
PRKCSH Polycystic liver disease AD 9 28
RPGRIP1L# COACH syndrome, Joubert syndrome, Meckel syndrome, Retinal degeneration in ciliopathy, modifier AR 39 49
SDCCAG8 Bardet-Biedl syndrome, Senior-Loken syndrome AR 14 18
SEC61A1 Hyperuricemic nephropathy, familial juvenile 4 AD 4 4
SEC63 Polycystic liver disease AD 8 23
SIX5 Branchiootorenal syndrome AD 3 10
TMEM67 Nephronophthisis, COACH syndrome, Joubert syndrome, Meckel syndrome AR 87 170
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195
TTC21B Short-rib thoracic dysplasia, Nephronophthisis, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 23 63
UMOD Familial juvenile hyperuricemic nephropathy, Glomerulocystic kidney disease with hyperuricemia and isosthenuria, Medullary cystic kidney disease 2 AD 33 108
VHL Erythrocytosis, familial, Pheochromocytoma, Von Hippel-Lindau disease AD/AR 206 614
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 33 43
ZNF423 Nephronophthisis, Joubert syndrome AD/AR 10 7
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Cystic Kidney Disease Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
CEP290 Chr12:88462434 c.6012-12T>A NM_025114.3 rs752197734
CEP290 Chr12:88494960 c.2991+1655A>G NM_025114.3 rs281865192
CEP290 Chr12:88508350 c.1910-11T>G NM_025114.3
CEP290 Chr12:88534822 c.103-18_103-13delGCTTTT NM_025114.3
COL4A1 Chr13:110802675 c.*35C>A NM_001845.4
COL4A1 Chr13:110802678 c.*32G>A/T NM_001845.4
COL4A1 Chr13:110802679 c.*31G>T NM_001845.4
EYA1 Chr8:72156939 c.1051-12T>G NM_000503.4
EYA1 Chr8:72211483 c.640-15G>A NM_000503.4
JAG1 Chr20:10629767 c.1349-12T>G NM_000214.2
OFD1 ChrX:13768358 c.935+706A>G NM_003611.2 rs730880283
OFD1 ChrX:13773245 c.1130-22_1130-19delAATT NM_003611.2 rs312262865
OFD1 ChrX:13773249 c.1130-20_1130-16delTTGGT NM_003611.2
PKD1 Chr16:2140209 c.12445-14T>C NM_001009944.2
PKD1 Chr16:2147825 c.10167+25_10167+43delGGCTGGGCTGGGGGTCCTG NM_001009944.2 rs1197421698
PKD1 Chr16:2152273 c.9202-16G>A NM_001009944.2
PKD2 Chr4:88940551 c.596-59A>G NM_000297.3 rs750504141
PKHD1 Chr6:51618610 c.8798-459C>A NM_138694.3
PKHD1 Chr6:51747238 c.7350+653A>G NM_138694.3
TSC1 Chr9:135800306 c.363+668G>A NM_000368.4
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
TSC2 Chr16:2106052 c.600-145C>T NM_000548.3
TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3
VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225
VHL Chr3:10191719 c.*70C>A NM_000551.3

Test Strengths

Exons 1-33 of the *PKD1* have multiple segmentally duplicated pseudogenes that reduce sensitivity of NGS diagnostics in general. However, Blueprint Genetics custom assay has good coverage (>20x) with high mapping rates (mapping quality >40) for 99.5% of the target regions in *PKD1* gene. Our validation showed high mean coverage of 199X for the *PKD1* gene. Thus, our NGS Panel is not expected to have major limitations in detecting variants in *PKD1* gene although clinical validation has not been performed at large scale.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: *RPGRIP1L* (NM_015272:23). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Marlborough, MA, are equivalent.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists, and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost, according to our latest follow-up reporting policy.