Core Reproductive Screen Duo with FMR1 repeat expansion New

Summary

Is a 126-gene panel for couples who want information about their chance to have a child with an autosomal recessive or X-linked genetic condition. This type of test is sometimes called carrier screening.

This test includes the analysis of the cytosine-guanine-guanine (CGG) repeat region in the 5’-untranslated region of the Fragile X Messenger Ribonucleoprotein 1 (FMR1) gene using PCR amplification and fragment size analysis to determine CGG repeat length.
Please note that, to ensure proper result of the repeat expansion analysis we require sample type to be blood, buccal, or DNA extracted from either of those two sample types.

Duo report will combine results of the two tested individuals, to provide reproductive risk assessment for a couple in one test. FMR1 repeat expansion analysis will be performed only for the female individual.

Please note that for DUO testing we must receive the samples from both individuals in order to start the analysis.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
126
Test code
CS0104

Summary

The Blueprint Genetics Core Reproductive Screen Duo with FMR1 repeat expansion (test code CS0104):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

The strengths of this test include:
-CAP-accredited laboratory
-CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
-Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
-Careful construction of clinically effective and scientifically justified gene panels
-Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
-Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
-~2,000 noncoding disease-causing variants in our clinical grade NGS assay for panels (please see ‘Noncoding disease-causing variants covered by this panel’ in the Panel Content section)
-Our rigorous variant classification scheme
-Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
-Our comprehensive clinical statements

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

The Core Reproductive Screen Duo with FMR1 repeat expansion is intended for healthy couples interested in carrier screening. Carrier screening gives individuals and/or couples an estimate of their chances of having a child affected with an autosomal recessive or X-linked condition. With this information, individuals or couples can discuss with their healthcare provider to make informed decisions about their reproductive options with medical advice. This might include choosing prenatal diagnosis, preimplantation genetic testing, use of a donor gamete/embryo, adoption, no testing, etc.

In a Duo report, results of the 2 tested individuals are combined to provide reproductive risk assessment for a couple in 1 test.
Core Reproductive Screen Duo with FMR1 repeat expansion includes screening for
-101 out of 113 disorders recommended by the American College of Obstetricians and Gynecologists (ACOG) and the American College of Medical Genetics (ACMG) (PMID: 34285390)
-The following conditions are not included due to limitations in variant detection by short-read NGS methods: alpha-methylacetoacetic aciduria (ACAT1),  Fragile XE syndrome (AFF2), congenital adrenal insufficiency (CYP11A1), hemophilia A (F8), Friedreich ataxia (FXN), Fraser syndrome 3 (GRIP1), Megalencephalic leukoencephalopathy with subcortical cysts 1 (MLC1), methylmalonic aciduria (MMUT), Schindler disease (NAGA), pontocerebellar hypoplasia type 6 (RARS2), atransferrinemia (TF), Ehlers-Danlos syndrome, classic-like (TNXB)
-Some serious childhood-onset conditions

Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.

FMR1 repeat expansion reporting includes findings consistent with intermediate CGG repeat length, premutation, and full mutation (PMID: 23765048).

Genes in the Core Reproductive Screen Duo with FMR1 repeat expansion

AARS2, ABCA3, ABCC6*, ABCC8, ABCD1*, ACADM, ACADVL, ADGRV1, AGA, AGXT, AHI1, AIRE, ALDOB, ALMS1*, ALPL, ANO10, ARSA, ARX#, ASL, ASPA, ASS1, ATP7B, BBS1, BBS10, BBS12, BBS2, BCKDHB, BLM, BTD, CASQ2, CBS, CC2D2A#, CCDC88C, CEP290*, CFTR, CHRNE, CLCN1, CLN3, CLRN1, CNGB3, COL7A1, CPT2, CYP21A2*, CYP27A1, CYP27B1, DHCR7, DHDDS, DLD, DMD, DYNC2H1, ERCC2, EVC2, F9, FAH, FANCA, FANCC, FKRP, FKTN, FMO3, FMR1, G6PC, GAA, GALT, GBA*, GBE1, GJB2, GJB6, GLA, GLB1, GNPTAB, HBA1*, HBA2#*, HBB, HEXA, HPS1*, HPS3, IDUA, IKBKAP, IVD, KIAA0586#, L1CAM, LRP2, MCCC2, MCOLN1, MCPH1#, MFSD8, MID1*, MMACHC, MVK, NEB#*, NPHS1, NR0B1, OCA2, OTC, PAH, PCCA, PCCB#, PCDH15, PEX1, PEX6, PEX7, PKHD1, PLP1, PMM2, POLG, PPT1, PRF1, RAG1, RMRP, RNASEH2B, RPGR, RS1, SCO2, SLC19A3, SLC26A2, SLC26A4, SLC37A4, SLC6A8*, SMN1#*, SMPD1, TECRL, TMEM216, TPP1, TYR*, USH2A, XPC

More information about this test content: Residual risk table.

#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Core Reproductive Screen Duo with FMR1 repeat expansion

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ABCA3 Chr16:2333457 c.3863-98C>T NM_001089.2 rs189077405
ABCA3 Chr16:2358644 c.1112-20G>A NM_001089.2 rs746701685
ABCA3 Chr16:2376495 c.-26-2A>G NM_001089.2
ABCC6 Chr16:16244424 c.4403+11C>G NM_001171.5 rs72664215
ABCC6 Chr16:16256835 c.3506+15G>A NM_001171.5 rs72664302
ABCC6 Chr16:16281097 c.1780-29T>A NM_001171.5 rs72664206
ABCC6 Chr16:16284246 c.1432-22C>A NM_001171.5 rs72664297
ABCC8 Chr11:17415959 c.4412-13G>A NM_000352.3 rs1008906426
ABCC8 Chr11:17427028 c.3399+13G>A NM_000352.3 rs182340196
ABCC8 Chr11:17449501 c.2041-12C>A NM_000352.3
ABCC8 Chr11:17449510 c.2041-21G>A NM_000352.3 rs746714109
ABCC8 Chr11:17449514 c.2041-25G>A NM_000352.3
ABCC8 Chr11:17452526 c.1672-20A>G NM_000352.3
ABCC8 Chr11:17465872 c.1333-1013A>G NM_000352.3
ABCC8 Chr11:17470268 c.1177-53_1177-51delGTG NM_000352.3 rs1271038564
ABCC8 Chr11:17498513 c.-190C>G NM_000352.3
ACADM Chr1:76200457 c.388-19T>A NM_000016.4
ACADM Chr1:76211473 c.600-18G>A NM_000016.4 rs370523609
ACADVL Chr17:7123160 c.-144_-132delCCCAGCATGCCCCinsT NM_000018.3
ACADVL Chr17:7125469 c.822-27C>T NM_001270447.1 rs374911841
ACADVL Chr17:7125485 c.822-11T>G NM_001270447.1
ACADVL Chr17:7126199 c.1146+15C>T NM_001270447.1 rs202237278
ACADVL Chr17:7126948 c.1252-15A>G NM_001270447.1 rs765390290
ACADVL Chr17:7127894 c.1747+23C>T NM_001270447.1 rs147546456
ALDOB Chr9:104183575 c.*516T>A NM_000035.3
ALDOB Chr9:104197990 c.-11+1G>C NM_000035.3 rs181639417
ALDOB Chr9:104198194 NM_000035.3 rs185972191
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
ARSA Chr22:51064121 c.1108-12C>G NM_000487.5 rs757806374
ARSA Chr22:51064129 c.1108-20A>G NM_000487.5
ASS1 Chr9:133327601 c.-5-10C>G NM_000050.4 rs375136377
ASS1 Chr9:133332669 c.175-1119G>A NM_000050.4
ASS1 Chr9:133355236 c.773+49C>T NM_000050.4 rs763389916
ATP7B Chr13:52518439 c.3061-12T>A NM_000053.3
ATP7B Chr13:52585551 c.-78A>C NM_000053.3
ATP7B Chr13:52585596 c.-123C>A NM_000053.3
ATP7B Chr13:52585596 c.-128_-124delAGCCG NM_000053.3
ATP7B Chr13:52585606 c.-133A>C NM_000053.3
ATP7B Chr13:52585683 c.-210A>T NM_000053.3
ATP7B Chr13:52585894 NM_000053.3 rs1484840087
ATP7B Chr13:52585897 NM_000053.3
ATP7B Chr13:52585915 c.-442G>A NM_000053.3
BBS1 Chr11:66291105 c.951+58C>T NM_024649.4
BTD Chr3:15683399 c.310-15delT NM_000060.2 rs587783008
BTD Chr3:15687154 c.*159G>A NM_000060.2 rs530872564
CBS Chr21:44496326 c.-86_-85+8delAGGTAGAAGA NM_001178008.1
CEP290 Chr12:88462434 c.6012-12T>A NM_025114.3 rs752197734
CEP290 Chr12:88494960 c.2991+1655A>G NM_025114.3 rs281865192
CEP290 Chr12:88508350 c.1910-11T>G NM_025114.3
CEP290 Chr12:88534822 c.103-18_103-13delGCTTTT NM_025114.3
CFTR Chr7:117119654 c.-495C>T NM_000492.3 rs397507565
CFTR Chr7:117119797 NM_000492.3
CFTR Chr7:117119900 c.-249G>C NM_000492.3
CFTR Chr7:117119984 c.-165G>A NM_000492.3 rs145483167
CFTR Chr7:117120064 c.-85C>G NM_000492.3
CFTR Chr7:117120115 c.-34C>T NM_000492.3 rs756314710
CFTR Chr7:117120325 c.53+124T>C NM_000492.3
CFTR Chr7:117179040 c.870-1113_870-1110delGAAT NM_000492.3 rs397508809
CFTR Chr7:117182041 c.1117-26_1117-25delAT NM_000492.3 rs397508159
CFTR Chr7:117199500 c.1393-18G>A NM_000492.3 rs397508199
CFTR Chr7:117218381 c.1585-9412A>G NM_000492.3 rs397508229
CFTR Chr7:117227774 c.1585-19T>C NM_000492.3 rs778457306
CFTR Chr7:117227921 c.1679+34G>T NM_000492.3 rs767901668
CFTR Chr7:117229521 c.1680-886A>G NM_000492.3 rs397508266
CFTR Chr7:117229524 c.1680-883A>G NM_000492.3
CFTR Chr7:117229530 c.1680-877G>T NM_000492.3 rs397508261
CFTR Chr7:117243855 c.2908+19G>C NM_000492.3 rs370683572
CFTR Chr7:117246713 c.2909-15T>G NM_000492.3 rs397508455
CFTR Chr7:117246840 c.2988+33G>T NM_000492.3
CFTR Chr7:117251609 c.3140-26A>G NM_000492.3 rs76151804
CFTR Chr7:117251619 c.3140-16T>A NM_000492.3 rs767232138
CFTR Chr7:117251624 c.3140-11A>G NM_000492.3
CFTR Chr7:117266272 c.3469-1304C>G NM_000492.3
CFTR Chr7:117267864 c.3717+40A>G NM_000492.3 rs397508595
CFTR Chr7:117280015 c.3718-2477C>T NM_000492.3 rs75039782
CFTR Chr7:117282680 c.3873+33A>G NM_000492.3 rs397508622
CFTR Chr7:117288374 c.3874-4522A>G NM_000492.3
CFTR Chr7:117308395 c.*1233T>A NM_000492.3
CHRNE Chr17:4804936 c.501-16G>A NM_000080.3
CHRNE Chr17:4806452 c.-94G>A NM_000080.3
CHRNE Chr17:4806453 c.-95G>A NM_000080.3
CHRNE Chr17:4806454 c.-96C>T NM_000080.3 rs748144899
CLCN1 Chr7:143013247 c.-59C>A NM_000083.2
CLCN1 Chr7:143029494 c.1167-15_1167-14delCT NM_000083.2 rs1214185689
CLN3 Chr16:28493392 c.1056+34C>A NM_000086.2
CLN3 Chr16:28497984 c.461-13G>C NM_000086.2 rs386833721
CLRN1 Chr3:150660197 c.254-649T>G NM_001195794.1 rs976853535
COL7A1 Chr3:48602516 c.8620+26G>A NM_000094.3
COL7A1 Chr3:48604008 c.8305-12T>A NM_000094.3
COL7A1 Chr3:48605244 c.7929+11_7929+26delGATGGGGGCTGGGGGG NM_000094.3 rs773394779
COL7A1 Chr3:48605981 c.7759-18_7759-14delCATCTinsTTCA NM_000094.3
COL7A1 Chr3:48613354 c.5821-19A>G NM_000094.3
COL7A1 Chr3:48616971 c.5236-23A>G NM_000094.3
COL7A1 Chr3:48626035 c.2587+40G>A NM_000094.3
COL7A1 Chr3:48629915 c.977-15G>A NM_000094.3
COL7A1 Chr3:48632779 c.-187C>T NM_000094.3
COL7A1 Chr3:48632780 c.-188C>T NM_000094.3
CYP21A2 Chr6:32006858 c.293-13C>G NM_000500.7 rs6467
DHDDS Chr1:26774026 c.441-24A>G NM_024887.3 rs764831063
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31897527 c.6913-4037T>G NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32274692 c.6290+30954C>T NM_004006.2
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32756908 c.650-39498A>G NM_004006.2
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DYNC2H1 Chr11:103019205 c.2819-14A>G NM_001080463.1 rs781091611
DYNC2H1 Chr11:103055609 c.6478-16G>A NM_001080463.1 rs376892534
F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612871 c.-53A>G NM_000133.3
F9 ChrX:138612871 NM_000133.3
F9 ChrX:138612872 c.-52C>G/T NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612874 c.-50T>C/G NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612875 c.-49T>A/C NM_000133.3
F9 ChrX:138612875 NM_000133.3
F9 ChrX:138612875 NM_000133.3 rs1178811105
F9 ChrX:138612876 c.-48G>C NM_000133.3
F9 ChrX:138612886 c.-38A>G NM_000133.3
F9 ChrX:138612889 c.-35G>A/C NM_000133.3
F9 ChrX:138612889 NM_000133.3 rs1166164399
F9 ChrX:138612889 NM_000133.3
F9 ChrX:138612890 c.-34A>G/T NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612899 c.-22delT NM_000133.3
F9 ChrX:138612900 c.-24T>A NM_000133.3
F9 ChrX:138612901 c.-23T>C NM_000133.3
F9 ChrX:138612902 c.-22T>C NM_000133.3
F9 ChrX:138612903 c.-21C>G NM_000133.3
F9 ChrX:138612905 c.-19C>G NM_000133.3
F9 ChrX:138612905 c.-17delA NM_000133.3
F9 ChrX:138612906 c.-18A>G/T NM_000133.3
F9 ChrX:138612906 c.-18A>T NM_000133.3
F9 ChrX:138612906 c.-18A>G NM_000133.3
F9 ChrX:138612907 c.-17A>C/G NM_000133.3
F9 ChrX:138612907 c.-17A>C NM_000133.3
F9 ChrX:138612907 c.-17A>G NM_000133.3
F9 ChrX:138619496 c.253-25A>G/T NM_000133.3
F9 ChrX:138619496 c.253-25A>T NM_000133.3
F9 ChrX:138619496 c.253-25A>G NM_000133.3 rs1201753038
F9 ChrX:138619501 c.253-19_253-16delCTTC NM_000133.3
F9 ChrX:138619502 c.253-16_253-12delCTTTT NM_000133.3
F9 ChrX:138623222 c.278-13A>G NM_000133.3
F9 ChrX:138623223 c.278-12C>G/T NM_000133.3
F9 ChrX:138623223 c.278-12C>G NM_000133.3
F9 ChrX:138623223 c.278-12C>T NM_000133.3 rs1475223858
F9 ChrX:138630499 c.392-22_392-21delCT NM_000133.3
F9 ChrX:138630663 c.520+13A>G NM_000133.3
F9 ChrX:138633441 c.723+18T>A NM_000133.3
F9 ChrX:138645387 c.*1157A>G NM_000133.3
F9 ChrX:138645598 c.*1368A>G NM_000133.3
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCA Chr16:89864654 c.893+920C>A NM_000135.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FKRP Chr19:47249328 c.-272G>A NM_024301.4
FKTN Chr9:108368857 c.648-1243G>T NM_006731.2
FMR1 ChrX:147031110 c.*746T>C NM_002024.5 rs183130936
G6PC Chr17:41059684 c.446+39G>A NM_000151.3
G6PC Chr17:41059687 c.446+42G>A NM_000151.3
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GALT Chr9:34646606 c.-96T>G NM_000155.3
GALT Chr9:34647075 c.83-11T>G NM_000155.3
GALT Chr9:34648082 c.508-29delT NM_000155.3 rs111033711
GALT Chr9:34648519 c.687+66T>A NM_000155.3
GALT Chr9:34648904 c.820+13A>G NM_000155.3 rs111033768
GALT Chr9:34649617 c.1059+56C>T NM_000155.3 rs111033821
GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3
GBA Chr1:155208109 c.589-12C>G NM_000157.3
GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445
GBE1 Chr3:81542964 c.2053-3358_2053-3350delGTGTGGTGGinsTGTTTTTTACATGACAGGT NM_000158.3 rs869320698
GJB2 Chr13:20763744 c.-22-2A>C NM_004004.5 rs201895089
GJB2 Chr13:20766920 c.-23+2T>A NM_004004.5
GJB2 Chr13:20766921 c.-23+1G>A NM_004004.5 rs80338940
GJB2 Chr13:20766922 c.-23G>T NM_004004.5 rs786204734
GJB2 Chr13:20767158 c.-259C>T NM_004004.5
GJB2 Chr13:20767159 c.-260C>T NM_004004.5
GLA ChrX:100653945 c.640-11T>A NM_000169.2
GLA ChrX:100654735 c.640-801G>A NM_000169.2 rs199473684
GLA ChrX:100654793 c.640-859C>T NM_000169.2 rs869312374
GLA ChrX:100656225 c.547+395G>C NM_000169.2
GNPTAB Chr12:102159106 c.1613-25delA NM_024312.4 rs777271928
HBA1 Chr16:227471 c.*63_*65delCCT NM_000558.3
HBA2 Chr16:223646 c.*47G>C NM_000517.4 rs4021971
HBA2 Chr16:223672 c.*74_*89delCCTTCCTGGTCTTTGA NM_000517.4 rs63750919
HBA2 Chr16:223690 c.*93_*94delAA NM_000517.4 rs63751268
HBA2 Chr16:223691 c.*92A>G NM_000517.4 rs63750067
HBA2 Chr16:223693 c.*94A>G NM_000517.4
HBA2 Chr16:223693 c.*94A>C NM_000517.4
HBA2 Chr16:223703 c.*104G>T NM_000517.4
HBB Chr11:5246696 c.*132C>A/T NM_000518.4
HBB Chr11:5246696 c.*132C>A NM_000518.4 rs1420779550
HBB Chr11:5246696 c.*132C>T NM_000518.4
HBB Chr11:5246699 c.*129T>C NM_000518.4
HBB Chr11:5246711 c.*115_*116delAA NM_000518.4 rs281864532
HBB Chr11:5246713 c.*110_*114delTAAAA NM_000518.4 rs606231219,rs35949130
HBB Chr11:5246715 c.*113A>G NM_000518.4 rs33985472
HBB Chr11:5246716 c.*112A>G/T NM_000518.4 rs63750954
HBB Chr11:5246716 c.*112A>T NM_000518.4
HBB Chr11:5246716 c.*112A>G NM_000518.4
HBB Chr11:5246716 c.*110_*111delTA NM_000518.4 rs63750205,rs281864905
HBB Chr11:5246717 c.*111A>G NM_000518.4 rs63751128
HBB Chr11:5246718 c.*110T>A/C NM_000518.4 rs33978907
HBB Chr11:5246718 c.*110T>G NM_000518.4
HBB Chr11:5246720 c.*108A>C/G NM_000518.4
HBB Chr11:5246720 c.*108A>C NM_000518.4
HBB Chr11:5246720 c.*108A>G NM_000518.4
HBB Chr11:5246722 c.*93_*105delATCTGGATTCTGC NM_000518.4 rs34171453
HBB Chr11:5246732 c.*96T>C NM_000518.4 rs34029390
HBB Chr11:5246754 c.*74A>G NM_000518.4 rs369101035
HBB Chr11:5246781 c.*47C>G NM_000518.4
HBB Chr11:5246796 c.*32A>C NM_000518.4
HBB Chr11:5246970 c.316-14T>G NM_000518.4 rs35703285
HBB Chr11:5247046 c.316-90A>G NM_000518.4 rs63750433
HBB Chr11:5247062 c.316-106C>G NM_000518.4 rs34690599
HBB Chr11:5247102 c.316-146T>G NM_000518.4 rs35328027
HBB Chr11:5247153 c.316-197C>T NM_000518.4 rs34451549
HBB Chr11:5247216 c.316-260T>C NM_000518.4
HBB Chr11:5247602 c.315+203_315+205delTCTinsCC NM_000518.4
HBB Chr11:5248044 c.93-15T>G NM_000518.4 rs35456885
HBB Chr11:5248050 c.93-21G>A NM_000518.4 rs35004220
HBB Chr11:5248050 c.93-22delT NM_000518.4
HBB Chr11:5248263 c.-12C>T NM_000518.4 rs113115948
HBB Chr11:5248269 c.-18C>G NM_000518.4 rs34135787
HBB Chr11:5248272 c.-21T>A NM_000518.4
HBB Chr11:5248280 c.-29G>A/T NM_000518.4 rs34704828
HBB Chr11:5248281 c.-31delC NM_000518.4
HBB Chr11:5248282 c.-31C>T NM_000518.4 rs63750628
HBB Chr11:5248291 c.-41delT NM_000518.4 rs35352549
HBB Chr11:5248294 c.-43C>T NM_000518.4
HBB Chr11:5248301 c.-50A>C NM_000518.4 rs34305195
HBB Chr11:5248301 c.-50A>G/T NM_000518.4
HBB Chr11:5248326 c.-75G>T NM_000518.4
HBB Chr11:5248326 c.-75G>C NM_000518.4 rs63750400
HBB Chr11:5248326 NM_000518.4 rs63750953
HBB Chr11:5248327 c.-76A>C NM_000518.4 rs281864525
HBB Chr11:5248328 c.-77A>G/T NM_000518.4
HBB Chr11:5248328 NM_000518.4
HBB Chr11:5248328 NM_000518.4
HBB Chr11:5248329 c.-78A>C/G NM_000518.4 rs33931746
HBB Chr11:5248329 NM_000518.4
HBB Chr11:5248329 NM_000518.4
HBB Chr11:5248330 c.-79A>G NM_000518.4 rs34598529
HBB Chr11:5248330 NM_000518.4 rs397509430
HBB Chr11:5248331 c.-80T>A/C NM_000518.4 rs33980857
HBB Chr11:5248331 NM_000518.4
HBB Chr11:5248331 NM_000518.4
HBB Chr11:5248332 c.-81A>C/G NM_000518.4 rs33981098
HBB Chr11:5248332 NM_000518.4
HBB Chr11:5248332 NM_000518.4
HBB Chr11:5248333 c.-82C>A/T NM_000518.4 rs34500389
HBB Chr11:5248333 NM_000518.4
HBB Chr11:5248333 NM_000518.4
HBB Chr11:5248342 c.-91A>C NM_000518.4
HBB Chr11:5248343 c.-92C>G NM_000518.4 rs397515291
HBB Chr11:5248351 c.-100G>A NM_000518.4 rs281864524
HBB Chr11:5248372 c.-121C>T NM_000518.4 rs281864518
HBB Chr11:5248373 NM_000518.4 rs1272414751
HBB Chr11:5248374 c.-123A>T NM_000518.4
HBB Chr11:5248377 c.-126C>A NM_000518.4
HBB Chr11:5248378 c.-127G>C NM_000518.4
HBB Chr11:5248384 NM_000518.4 rs72561473
HBB Chr11:5248387 c.-136C>A/G/T NM_000518.4 rs33994806
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248388 c.-137C>A/G/T NM_000518.4 rs33941377
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248389 c.-138C>A/T NM_000518.4 rs33944208
HBB Chr11:5248389 NM_000518.4
HBB Chr11:5248389 NM_000518.4
HBB Chr11:5248391 NM_000518.4 rs34999973
HBB Chr11:5248393 c.-142C>T NM_000518.4 rs34883338
HBB Chr11:5248394 c.-143C>G NM_000518.4 rs63751043
HBB Chr11:5248402 c.-151C>T NM_000518.4 rs63751208
HBB Chr11:5248402 NM_000518.4
HBB Chr11:5248403 c.-152C>A NM_000518.4
HBB Chr11:5248491 c.-240G>A NM_000518.4 rs753344875
HBB Chr11:5248524 c.-273T>C NM_000518.4 rs139703273
HEXA Chr15:72640009 c.1146+18A>G NM_000520.4
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
L1CAM ChrX:153128846 c.3531-12G>A NM_000425.4
L1CAM ChrX:153131293 c.2432-19A>C NM_000425.4
L1CAM ChrX:153133652 c.1704-75G>T NM_000425.4
L1CAM ChrX:153133926 c.1547-14delC NM_000425.4
L1CAM ChrX:153136500 c.523+12C>T NM_000425.4
MCCC2 Chr5:70898313 c.384-20A>G NM_022132.4 rs770917710
MCCC2 Chr5:70939634 c.1073-12C>G NM_022132.4 rs1280511914
MVK Chr12:110029032 c.769-7dupT NM_000431.2 rs104895348
NEB Chr2:152355017 c.24220-151C>A NM_001271208.1
NEB Chr2:152410918 c.19429-381_19429-379delTTTinsA NM_001271208.1
NPHS1 Chr19:36335378 c.1931-17C>A NM_004646.3
NPHS1 Chr19:36336259 c.1930+11C>A NM_004646.3
NPHS1 Chr19:36343206 c.-475_-468delGAGAGAGA NM_004646.3 rs386833860
OCA2 Chr15:28234823 c.1117-11T>A NM_000275.2
OCA2 Chr15:28234829 c.1117-17T>C NM_000275.2 rs200081580
OCA2 Chr15:28235808 c.1045-15T>G NM_000275.2 rs779461179
OCA2 Chr15:28267738 c.574-19A>G NM_000275.2 rs145242923
OTC ChrX:38202566 c.-9384G>T NM_000531.5
OTC ChrX:38211584 NM_000531.5 rs191615506
OTC ChrX:38211793 c.-157T>G NM_000531.5
OTC ChrX:38211808 c.-142G>A NM_000531.5
OTC ChrX:38211811 c.-139A>G NM_000531.5
OTC ChrX:38211834 c.-116C>T NM_000531.5
OTC ChrX:38211835 c.-115C>T NM_000531.5
OTC ChrX:38211844 c.-106C>A NM_000531.5 rs749748052
OTC ChrX:38260946 c.540+265G>A NM_000531.5
OTC ChrX:38269404 c.867+1126A>G NM_000531.5
OTC ChrX:38272343 c.1005+1091C>G NM_000531.5
PAH Chr12:103232809 c.*144A>G NM_000277.1 rs375319584
PAH Chr12:103237404 c.1199+20G>C NM_000277.1 rs62509018
PAH Chr12:103237407 c.1199+17G>A NM_000277.1 rs62508613
PAH Chr12:103237568 c.1066-11G>A NM_000277.1 rs5030855
PAH Chr12:103237568 c.1066-12delT NM_000277.1
PAH Chr12:103237570 c.1066-13T>G NM_000277.1
PAH Chr12:103237571 c.1066-14C>G NM_000277.1 rs62507334
PAH Chr12:103238075 c.1065+39G>T NM_000277.1 rs62510582
PAH Chr12:103260355 c.509+15_509+18delCTTG NM_000277.1 rs1335303703
PAH Chr12:103288709 c.169-13T>G NM_000277.1 rs62507341
PCCA Chr13:100958030 c.1285-1416A>G NM_000282.3
PCCB Chr3:136003251 c.714+462A>G NM_001178014.1
PCDH15 Chr10:56560684 c.-29+1G>C NM_001142763.1
PEX6 Chr6:42933858 c.2301-15C>G NM_000287.3 rs267608236
PEX6 Chr6:42933952 c.2300+28G>A NM_000287.3 rs267608237
PEX7 Chr6:137143759 c.-45C>T NM_000288.3 rs267608252
PKHD1 Chr6:51618610 c.8798-459C>A NM_138694.3
PKHD1 Chr6:51747238 c.7350+653A>G NM_138694.3
PLP1 ChrX:103031997 c.4+78_4+85delGGGGGTTC NM_000533.3
PLP1 ChrX:103041680 c.453+28_453+46delTAACAAGGGGTGGGGGAAA NM_000533.3
PLP1 ChrX:103042405 c.454-322G>A NM_000533.3
PLP1 ChrX:103042413 c.454-314T>A/G NM_000533.3
PLP1 ChrX:103042413 c.454-314T>A NM_000533.3
PLP1 ChrX:103042413 c.454-314T>G NM_000533.3
PMM2 Chr16:8891573 NM_000303.2
PMM2 Chr16:8898599 c.179-25A>G NM_000303.2 rs760689221
PMM2 Chr16:8926102 c.640-15479C>T NM_000303.2 rs1258107584
PMM2 Chr16:8941558 c.640-23A>G NM_000303.2
PPT1 Chr1:40539203 c.*526_*529delATCA NM_000310.3 rs386833624
PPT1 Chr1:40558194 c.125-15T>G NM_000310.3 rs386833629
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
RNASEH2B Chr13:51501530 c.65-13G>A NM_024570.3
RNASEH2B Chr13:51519550 c.511-13G>A NM_024570.3
RPGR ChrX:38128234 NM_000328.2
RPGR ChrX:38160137 c.1059+363G>A NM_001034853.1
SLC19A3 Chr2:228560811 c.980-14A>G NM_025243.3 rs200542114
SLC26A2 Chr5:149340544 c.-26+2T>C NM_000112.3 rs386833492
SLC26A4 Chr7:107301201 c.-103T>C NM_000441.1 rs60284988
SLC26A4 Chr7:107301244 c.-60A>G NM_000441.1 rs545973091
SLC26A4 Chr7:107301301 c.-4+1G>C NM_000441.1
SLC26A4 Chr7:107301305 c.-4+5G>A NM_000441.1 rs727503425
SLC26A4 Chr7:107323842 c.918+45_918+47delCAA NM_000441.1
SLC26A4 Chr7:107330533 c.1150-35_1150-28delTTTGTAGG NM_000441.1
SLC26A4 Chr7:107334836 c.1264-12T>A NM_000441.1
SLC26A4 Chr7:107336364 c.1438-7dupT NM_000441.1 rs754734032
SLC26A4 Chr7:107341513 c.1708-27_1708-11delTAAGTAACTTGACATTT NM_000441.1
SLC26A4 Chr7:107350439 c.2090-52_2090-49delCAAA NM_000441.1
SMPD1 Chr11:6415102 c.1341-21_1341-18delAATG NM_000543.4 rs1312743513
TPP1 Chr11:6637752 c.887-18A>G NM_000391.3
TYR Chr11:88960973 c.1037-18T>G NM_000372.4
USH2A Chr1:215821092 c.14583-20C>G NM_206933.2
USH2A Chr1:215967783 c.9959-4159A>G NM_206933.2
USH2A Chr1:216039721 c.8845+628C>T NM_206933.2
USH2A Chr1:216064540 c.7595-2144A>G NM_206933.2 rs786200928
USH2A Chr1:216247476 c.5573-834A>G NM_206933.2
USH2A Chr1:216592035 c.486-14G>A NM_206933.2 rs374536346
USH2A Chr1:216596610 c.-259G>T NM_206933.2
XPC Chr3:14187285 c.*156G>A NM_004628.4 rs121965092
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

Test Strengths

The strengths of this test include:
-CAP-accredited laboratory
-CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
-Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
-Careful construction of clinically effective and scientifically justified gene panels
-Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
-Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
-~2,000 noncoding disease-causing variants in our clinical grade NGS assay for panels (please see ‘Noncoding disease-causing variants covered by this panel’ in the Panel Content section)
-Our rigorous variant classification scheme
-Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
-Our comprehensive clinical statements

The strengths of this test include:

  • CAP-accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods, and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal provides transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrates complete details of test performance
  • ~2,000 non-coding disease-causing variants in our clinical-grade NGS assay for panels (please see ‘Non-coding disease-causing variants covered by this test’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enables accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

This test does not detect the following:
-Complex inversions
-Gene conversions
-Balanced translocations
-Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
-Repeat expansion disorders unless specifically mentioned
-Noncoding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:
-Low-level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
-Stretches of mononucleotide repeats
-Low-level heteroplasmy in mtDNA (>90% are detected at 5% level)
-Indels larger than 50bp
-Single exon deletions or duplications
-Variants within pseudogene regions/duplicated segments
-Some disease-causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.

CFTR: The 5T and associated TG repeat variants are not reported as their relevance in relation to classical cystic fibrosis is unclear and this test is not intended to screen for risk of congenital bilateral absence of the vas deferens (CBAVD) or CFTR-related pancreatitis risk.

CYP21A2 (NM_000500.9): only the following variants are reported:

c.955C>T p.(Gln319*)

c.844G>T p.(Val282Leu)

c.293-13C>G

c.1360C>T p.(Pro454Ser)

c.518T>A p.(Ile173Asn)

c.1447C>T p.(Pro483Ser)

c.92C>T p.(Pro31Leu)

FMR1: Repeat expansion reporting includes findings consistent with intermediate CGG repeat length (45-54), premutation (55-200) and full mutation (>200 repeats) (PMID: 23765048). Indication of AGG interruptions is reported for female carriers of premutations but specific nature of the repeat (presence and number of AGG interruptions) will require confirmation using additional methods.

HBA1 and HBA2 genes have identical sequences at coding region and their mapping rely purely on differences at intronic/UTR regions. This reduces sensitivity for detecting variants in this region by using standard NGS diagnostics. However, Blueprint Genetics custom assay has good coverage (>20x) with improved mapping rates (mapping quality >40) within the target regions of these genes:  HBA1 80.7% and HBA2 59.4%. Our validation showed high mean coverage of 604x for HBA1 gene and 463x for HBA2. We have been able to detect sequence variants and the common disease-causing deletions using our assay but some limitations in sensitivity is expected to exist at the moment.

SMN1: Analysis includes only SMN1 copy number analysis, sequence variants are not included in this test. “Silent” carriers of SMA (individuals with two copies of SMN1 on one allele, and zero copies on the other allele) is not detected with this test. We do not include SMN1 c.*3+80T>G as this is mostly uninformative in the general population. This variant is common in African American individuals (27% carrier frequency) where it poorly predicts SMN1 2+0 allele status and it is rare in Ashkenazi Jewish individuals (3.5% carrier frequency) where it reliably predicts SMN1 2+0 allele status (PMID: 23788250).

TYR: The c.1205G>A, p.(Arg402Gln) (NM_000372.5) hypomorphic variant is typically associated with mild skin/hair/eye pigmentation changes and is therefore not reported as this test is intended to identify variants that cause severe TYR-related oculocutaneous albinism.

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes ProjectgnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFTPolyPhenMutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with the most comprehensive report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists prepare the report by assessing the pathogenicity of the identified variants. Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics.  

Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Only variants classified as pathogenic or likely pathogenic based on an ACMG/AMP classification scheme will be reported.  

Our screening panel report includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the report includes descriptions of the variant and its association with disease. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.  

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis, or in proactive testing, to confer a risk of developing an inherited disease. In reproductive screening, identification of single pathogenic or likely pathogenic variants in genes related to recessive disorders is considered as a carriership. Disease risk of potential offspring depends on whether both parents have a pathogenic or likely pathogenic variant in the same gene. Reproductive risk related to X-linked disorders may be difficult to estimate due to the possibility of skewed X-chromosome inactivation. Genetic counseling is recommended whenever pathogenic or likely pathogenic variants are reported. 

Reporting focuses on high-quality variants that meet our stringent NGS quality metrics for a true positive call but they are not confirmed with alternative methods. Ordering healthcare professionals should consider further confirmation of the reported variants using a diagnostic test.