Bleeding Disorder/Coagulopathy Panel

  • Is a 71 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of an inherited bleeding disorder.

    Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions.

Analysis methods
  • PLUS

4 weeks

Number of genes


Test code


Panel size


CPT codes


The Blueprint Genetics Bleeding Disorder/Coagulopathy Panel (test code HE1301):

ICD codes

Commonly used ICD-10 code(s) when ordering the Bleeding Disorder/Coagulopathy Panel

ICD-10 Disease
E70.30 Hermansky-Pudlak syndrome
D68.0 Von Willebrand disease type 1
D69.1 Bernard-Soulier syndrome
D69.1 Glanzmann thrombasthenia
D69.1 Gray platelet syndrome
D69.4 MYH9-related disease
D69.42 Congenital thrombotic thrombocytopenic purpura
D82.0 Wiskott-Aldrich syndrome
D66 Severe hemophilia A
D67 Severe hemophilia B
D68.2 Congenital factor II deficiency
D68.2 Congenital factor V deficiency
D68.2 Congenital factor VII deficiency
D68.2 Congenital factor X deficiency
D68.1 Congenital factor XI deficiency
D68.2 Hereditary combined deficiency of vitamin K-dependent clotting factors
D69.4 Familial platelet syndrome with predisposition to acute myelogenous leukemia
D69.42 Congenital amegakaryocytic thrombocytopenia

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Oragene DNA OG-500 kit/OGD-500 or OG-575 & OGD-575)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. Read more about our sample requirements here.

Bleeding disorder refers to a heterogenous group of diseases caused by deficiencies in platelet function or coagulation factors. The bleeding disorders can be categorized into three groups: 1) the common inherited bleeding disorders, hemophilia A, B, and von Willebrand disease (VWD); (2) the rare inherited coagulation factor deficiencies; and (3) inherited platelet disorders (PMID: 24124085). VWD is the most common inherited bleeding disorder, affecting up to 1% of the general population and occuring with equal frequency among men and women. The phenotypes that are covered by the panel include VWD, hemophilia A and B, rare bleeding disorders, Hermansky Pudlak syndrome, Wiskott-Aldrich syndrome, Bernard Soulier syndrome, Glanzmann disease, thrombocytopenia 2, familial platelet syndrome with predisposition to acute myelogenous leukemia and gray platelet syndrome. The molecular knowledge gained from genetic testing is currently routinely used in the clinical care of the patients with hereditary bleeding disorder.

Genes in the Bleeding Disorder/Coagulopathy Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ABCG5 Sitosterolemia AR 13 42
ABCG8 Sitosterolemia AR 18 44
ACTN1 Bleeding disorder, platelet- AD 7 25
ADAMTS13 Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, familial AR 30 183
ANKRD26 Thrombocytopenia AD 6 21
AP3B1 Hermansky-Pudlak syndrome AR 14 34
ARPC1B Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease AR 2 4
BLOC1S3 Hermansky-Pudlak syndrome AR 2 4
BLOC1S6 Hermansky-Pudlak syndrome AR 1 2
CYCS* Thrombocytopenia AD 2 3
DTNBP1 Hermansky-Pudlak syndrome AR 2 3
EFL1* Shwachman-Diamond syndrome 3 2
ETV6 Thrombocytopenia 5 AD 10 38
F10 Factor X deficiency AR 15 155
F11 Factor XI deficiency AD/AR 77 271
F12 Angioedema, Factor XII deficiency AD/AR 7 53
F13A1 Factor XIIIA deficiency AR 20 180
F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, congenital AD/AR 14 66
F5 Factor V deficiency, Thrombophilia due to activated protein C resistance AD/AR 19 157
F7 Factor VII deficiency AR 27 322
F8* Hemophilia A XL 296 3205
F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX defect XL 117 1281
FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis AD/AR 10 144
FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital AD/AR 6 92
FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital AD/AR 7 127
FLI1 Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet type 21 AD 7 7
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects XL 133 257
FYB Thrombocytopenia 3 AR 2 2
GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia XL 21 15
GBA* Gaucher disease AR 84 488
GFI1B Bleeding disorder, platelet-type, 17 AD 6 9
GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation factor deficiency, Vitamin K-dependent clotting factors, combined deficiency AD/AR/Digenic 13 42
GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73
GP1BB Giant platelet disorder, isolated, Bernard-Soulier syndrome AD/AR 5 53
GP9 Bernard-Soulier syndrome AR 6 42
HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1
HPS1* Hermansky-Pudlak syndrome AR 28 55
HPS3 Hermansky-Pudlak syndrome AR 10 17
HPS4 Hermansky-Pudlak syndrome AR 16 22
HPS5 Hermansky-Pudlak syndrome AR 20 31
HPS6 Hermansky-Pudlak syndrome AR 13 37
ITGA2 Fetal and neonatal alloimmune thrombocytopenia AD/AR 5
ITGA2B Glanzmann thrombasthenia AD/AR 22 234
ITGB3 Bleeding disorder, platelet-, Thrombocytopenia, neonatal alloimmune, Glanzmann thrombasthenia AD/AR 18 165
LMAN1 Combined factor V and VIII deficiency AR 5 37
MASTL Thrombocytopenia AD 5
MCFD2 Factor V & Factor VIII, combined deficiency of AR 8 20
MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27
MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55
MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17 AD 25 117
NBEAL2 Gray platelet syndrome AR 10 51
P2RY12 Bleeding disorder, platelet- AD/AR 4 13
PRKACG Bleeding disorder, platelet-type, 19 AR 1 1
PROC Thrombophilia, hereditary AD/AR 36 387
PROS1* Thrombophilia, hereditary AD/AR 23 416
RASGRP2 Bleeding disorder, platelet-type, 18 AR 3 20
RBM8A* Thrombocytopenia - absent radius AD/AR 5 12
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SERPINC1 Antithrombin III deficiency AD/AR 44 412
SERPINF2 Alpha-2-plasmin inhibitor deficiency AD/AR 4 8
SLFN14 Thrombocytopenia AD/AR 4 4
SRC Thrombocytopenia, autosomal dominant, 6 AD 2 1
SRP54 Shwachman-Diamond syndrome AD 3
TBXA2R Bleeding disorder, platelet- AD 1 6
THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic syndrome, atypical AD 5 28
THPO Thrombocythemia 1 AD 5 10
TUBB1 Macrothrombocytopenia AD 2 7
VKORC1# Drug metabolism, VKORC1-related, Vitamin K-dependent clotting factors, combined deficiency AD/AR 4 27
VWF* Von Willebrand disease AD/AR 57 1009
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome XL 57 439
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by Bleeding Disorder/Coagulopathy Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
F11 Chr4:187186995 c.-456G>A NM_000128.3
F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853
F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976
F12 Chr5:176836590 NM_000505.3 rs187018744
F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3
F2 Chr11:46742048 c.241-25C>G NM_000506.3
F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963
F2 Chr11:46761064 c.*106T>A NM_000506.3
F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
F7 Chr13:113760060 NM_000131.4
F7 Chr13:113760062 NM_000131.4 rs1263426144
F7 Chr13:113760091 NM_000131.4 rs1187329967
F7 Chr13:113760094 NM_000131.4
F7 Chr13:113760094 NM_000131.4
F7 Chr13:113760095 NM_000131.4 rs1367115848
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760097 NM_000131.4 rs1455622259
F7 Chr13:113760099 NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666
F7 Chr13:113760117 c.-39A>G NM_000131.4
F7 Chr13:113760124 c.-32A>C NM_000131.4
F7 Chr13:113760126 c.-30A>C NM_000131.4
F7 Chr13:113764993 c.131-11G>A NM_000131.4
F7 Chr13:113766228 c.291+1065delC NM_000131.4
F7 Chr13:113770192 c.571+78G>A NM_000131.4 rs764741909
F7 Chr13:113771068 c.572-12T>A NM_000131.4
F8 ChrX:154084603 c.6900+4104A>T NM_000132.3
F8 ChrX:154091516 c.6430-14A>G NM_000132.3
F8 ChrX:154130453 c.5999-11G>A NM_000132.3 rs782132907
F8 ChrX:154130463 c.5999-23_5999-22delCT NM_000132.3
F8 ChrX:154130464 c.5999-33_5999-22delGAAATAATTTCTinsATTC NM_000132.3
F8 ChrX:154130469 c.5999-33_5999-28delGAAATA NM_000132.3
F8 ChrX:154130719 c.5999-277G>A NM_000132.3
F8 ChrX:154131240 c.5999-798G>A NM_000132.3
F8 ChrX:154132376 c.5816-14_5816-13delGTinsTA NM_000132.3
F8 ChrX:154132397 c.5816-34A>T NM_000132.3 rs782301004
F8 ChrX:154132892 c.5587-93C>T NM_000132.3
F8 ChrX:154134863 c.5220-16_5220-15insA NM_000132.3
F8 ChrX:154174820 c.2113+1152delA NM_000132.3
F8 ChrX:154175961 c.2113+12T>A NM_000132.3
F8 ChrX:154176219 c.1904-37G>A NM_000132.3 rs367615232
F8 ChrX:154185464 c.1538-18G>A NM_000132.3
F8 ChrX:154189025 c.1537+325A>G NM_000132.3
F8 ChrX:154189458 c.1444-15C>A NM_000132.3
F8 ChrX:154197841 c.788-14T>G NM_000132.3
F8 ChrX:154213089 c.671-11T>C NM_000132.3
F8 ChrX:154215591 c.602-11T>G NM_000132.3
F8 ChrX:154215612 c.602-32A>G NM_000132.3
F8 ChrX:154219579 c.601+1632G>A NM_000132.3 rs387906429
F8 ChrX:154221439 c.389-16T>G NM_000132.3
F8 ChrX:154227886 c.144-11T>G NM_000132.3
F8 ChrX:154227901 c.144-26A>T NM_000132.3
F8 ChrX:154238632 c.144-10758_144-10757insTATA NM_000132.3
F8 ChrX:154249118 c.143+1567A>G NM_000132.3
F8 ChrX:154250939 c.-112G>A NM_000132.3 rs1317271565
F8 ChrX:154251045 c.-218T>C NM_000132.3
F8 ChrX:154251045 NM_000132.3
F8 ChrX:154251046 c.-219C>T NM_000132.3
F8 ChrX:154251048 c.-221T>A NM_000132.3
F8 ChrX:154251082 c.-255A>G NM_000132.3
F8 ChrX:154251084 c.-257T>C/G NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251687 c.-860A>G NM_000132.3
F8 ChrX:154251793 c.-966G>T NM_000132.3
F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612871 c.-53A>G NM_000133.3
F9 ChrX:138612871 NM_000133.3
F9 ChrX:138612872 c.-52C>G/T NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612874 c.-50T>C/G NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612875 c.-49T>A/C NM_000133.3
F9 ChrX:138612875 NM_000133.3
F9 ChrX:138612875 NM_000133.3 rs1178811105
F9 ChrX:138612876 c.-48G>C NM_000133.3
F9 ChrX:138612886 c.-38A>G NM_000133.3
F9 ChrX:138612889 c.-35G>A/C NM_000133.3
F9 ChrX:138612889 NM_000133.3 rs1166164399
F9 ChrX:138612889 NM_000133.3
F9 ChrX:138612890 c.-34A>G/T NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612899 c.-22delT NM_000133.3
F9 ChrX:138612900 c.-24T>A NM_000133.3
F9 ChrX:138612901 c.-23T>C NM_000133.3
F9 ChrX:138612902 c.-22T>C NM_000133.3
F9 ChrX:138612903 c.-21C>G NM_000133.3
F9 ChrX:138612905 c.-19C>G NM_000133.3
F9 ChrX:138612905 c.-17delA NM_000133.3
F9 ChrX:138612906 c.-18A>G/T NM_000133.3
F9 ChrX:138612906 c.-18A>T NM_000133.3
F9 ChrX:138612906 c.-18A>G NM_000133.3
F9 ChrX:138612907 c.-17A>C/G NM_000133.3
F9 ChrX:138612907 c.-17A>C NM_000133.3
F9 ChrX:138612907 c.-17A>G NM_000133.3
F9 ChrX:138619496 c.253-25A>G/T NM_000133.3
F9 ChrX:138619496 c.253-25A>T NM_000133.3
F9 ChrX:138619496 c.253-25A>G NM_000133.3 rs1201753038
F9 ChrX:138619501 c.253-19_253-16delCTTC NM_000133.3
F9 ChrX:138619502 c.253-16_253-12delCTTTT NM_000133.3
F9 ChrX:138623222 c.278-13A>G NM_000133.3
F9 ChrX:138623223 c.278-12C>G/T NM_000133.3
F9 ChrX:138623223 c.278-12C>G NM_000133.3
F9 ChrX:138623223 c.278-12C>T NM_000133.3 rs1475223858
F9 ChrX:138630499 c.392-22_392-21delCT NM_000133.3
F9 ChrX:138630663 c.520+13A>G NM_000133.3
F9 ChrX:138633441 c.723+18T>A NM_000133.3
F9 ChrX:138645387 c.*1157A>G NM_000133.3
F9 ChrX:138645598 c.*1368A>G NM_000133.3
FGB Chr4:155486360 c.115-600A>G NM_005141.4
FGB Chr4:155490472 c.958+13C>T NM_005141.4 rs606231223
FGG Chr4:155527225 c.1129+632A>G NM_021870.2 rs2066862
FGG Chr4:155527787 c.1129+66_1129+69delAATA NM_021870.2 rs139788771
FGG Chr4:155530122 c.667-320A>T NM_021870.2
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3
GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3
GBA Chr1:155208109 c.589-12C>G NM_000157.3
GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445
GP1BB Chr22:19710933 c.-160C>G NM_000407.4 rs730882059
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
ITGA2B Chr17:42449567 c.*165T>C NM_000419.3
ITGA2B Chr17:42455177 c.2095-19T>A NM_000419.3
ITGA2B Chr17:42458507 c.1211-78A>G NM_000419.3
ITGA2B Chr17:42463181 c.408+11C>A NM_000419.3
ITGA2B Chr17:42470923 c.-4082G>A NM_000419.3
LMAN1 Chr18:57014710 c.822+34_822+35insGTTG NM_005570.3
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
THBD Chr20:23030319 NM_000361.2
THBD Chr20:23030443 c.-302C>A NM_000361.2
VWF Chr12:6101204 c.6599-20A>T NM_000552.3 rs61750621
VWF Chr12:6125417 c.5312-19A>G NM_000552.3
VWF Chr12:6128923 c.3675-14G>A NM_000552.3 rs1369248196
VWF Chr12:6233584 c.-1+3A>C NM_000552.3
VWF Chr12:6233714 c.-128G>A NM_000552.3 rs1300771136
VWF Chr12:6234258 c.-672C>T NM_000552.3 rs61750447
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2

Added and removed genes from the panel

Genes added Genes removed

Test Strengths

The strengths of this test include:
  • CAP and ISO-15189 accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

This NGS-based analysis does not include analysis of the intron 1 and intron 22 inversions in F8-gene. The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: VKORC1 (NM_001311311:3). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics bleeding disorder/Coagulopathy panel covers classical genes associated with Hermansky-Pudlak syndrome, Von Willebrand disease type 1, Bernard-Soulier syndrome, Glanzmann thrombasthenia, Gray platelet syndrome, MYH9-related disease, congenital thrombotic thrombocytopenic purpura, Wiskott-Aldrich syndrome, severe hemophilia A, severe hemophilia B, congenital factor II deficiency, congenital factor V deficiency, congenital factor VII deficiency, congenital factor X deficiency, congenital factor XI deficiency, hereditary combined deficiency of vitamin K-dependent clotting factors, inherited bleeding disorder, Familial platelet syndrome with predisposition to acute myelogenous leukemia and congenital amegakaryocytic thrombocytopenia. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient’s phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999
Insertions, deletions and indels by sequence analysis
1-10 bps 96.9% (7,563/7,806) >99.9999
11-50 bps 99.13% (2,524/2,546) >99.9999
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
The performance presented above reached by WES with the following coverage metrics
Mean sequencing depth at exome level 143X
Nucleotides with >20x sequencing coverage (%) 99.86%


The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis is orthogonal confirmation. Sequence variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing when they do not meet our stringent NGS quality metrics for a true positive call.
Reported heterozygous and homo/hemizygous copy number variations with a size <10 and <3 target exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen and confirmed less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Subscribe to our newsletter