Bone Marrow Failure Syndrome Panel

Updated
Summary
  • Is a 135 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of inherited bone marrow failure syndromes. The genes on this panel are included in the Comprehensive Hematology Panel.

Analysis methods
  • PLUS
Availability

4 weeks

Number of genes

135

Test code

HE0801

Panel size

Large

CPT codes
81479

Summary

The Blueprint Genetics Bone Marrow Failure Syndrome Panel (test code HE0801):

ICD codes

Commonly used ICD-10 code(s) when ordering the Bone Marrow Failure Syndrome Panel

ICD-10 Disease
E70.30 Hermansky-Pudlak syndrome
D61.01 Diamond-Blackfan anemia
D61.09 Fanconi anemia
D82.0 Wiskott-Aldrich syndrome
Q82.2 Bloom syndrome
D61.01 Shwachman-Diamond syndrome
D76.1 Familial hemophagocytic lymphohistiocytosis
D70.9 Severe congenital neutropenia
Q82.8 Dyskeratosis congenita

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Oragene DNA OG-500 kit/OGD-500 or OG-575 & OGD-575)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. Read more about our sample requirements here.

Inherited bone marrow failure syndromes (IBMFS) are a diverse set of genetic disorders characterized by the inability of the bone marrow to produce sufficient circulating blood cells. Bone marrow failure can affect all blood cell lineages causing clinical symptoms similar to aplastic anemia, or be restricted to one or two blood cell lineages. The clinical presentation may include thrombocytopenia or neutropenia. Hematological manifestations may be accompanied by physical features such as short stature and abnormal skin pigmentation in Fanconi anemia and dystrophic nails, lacy reticular pigmentation and oral leukoplakia in dyskeratosis congenita. Patients with IBMFS have an increased risk of developing cancer—either hematological or solid tumors. Early and correct disease recognition is important for management and surveillance of the diseases. Currently, accurate genetic diagnosis is essential to confirm the clinical diagnosis. The most common phenotypes that are covered by the panel are Fanconi anemia, Diamond-Blackfan anemia, dyskeratosis congenita, Shwachman-Diamond syndrome and WAS-related disorders.

Genes in the Bone Marrow Failure Syndrome Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ACD Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7 AD/AR 2 8
ACTB* Baraitser-Winter syndrome AD 55 60
AK2 Reticular dysgenesis AR 14 17
ANKRD26 Thrombocytopenia AD 6 21
AP3B1 Hermansky-Pudlak syndrome AR 14 34
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATR Cutaneous telangiectasia and cancer syndrome, Seckel syndrome AD/AR 10 33
BLM Bloom syndrome AR 152 119
BLOC1S3 Hermansky-Pudlak syndrome AR 2 4
BLOC1S6 Hermansky-Pudlak syndrome AR 1 2
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 134 65
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 3369 2659
BRIP1 Fanconi anemia, Breast cancer AD/AR 238 189
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 24 43
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) AR 26 25
CSF2RA#* Surfactant metabolism dysfunction, pulmonary XL 2 17
CSF3R Neutrophilia, hereditary AD 13 13
CTC1 Cerebroretinal microangiopathy with calcifications and cysts AR 21 33
CTSC Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre syndrome AR 19 92
CXCR4 Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome AD 5 15
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 9 21
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNASE2 Primary immunodeficiency 2
DTNBP1 Hermansky-Pudlak syndrome AR 2 3
EFL1* Shwachman-Diamond syndrome 3 2
ELANE Neutropenia AD 43 217
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 13 70
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
ETV6 Thrombocytopenia 5 AD 10 38
FADD Infections, recurrent, with encephalopathy, hepatic dysfunction, and cardiovascular malformations AR 2 1
FANCA Fanconi anemia AR 191 677
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FANCD2* Fanconi anemia AR 21 61
FANCE Fanconi anemia AR 4 17
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 16 92
FANCI Fanconi anemia AR 13 45
FANCL Fanconi anemia AR 13 24
FANCM Fanconi anemia AR 6 50
FAS Autoimmune lymphoproliferative syndrome AD/AR 31 133
FASLG Autoimmune lymphoproliferative syndrome, type IB AD 2 10
G6PC3 Neutropenia, severe congenital, Dursun syndrome AR 11 37
GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta-thalessemia,, Dyserythropoietic anemia with thrombocytopenia XL 21 15
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GFI1 Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, nonimmune chronic idiopathic, of adults AD 2 6
GINS1 Immunodeficiency AR 4 4
HAX1 Neutropenia, severe congenital AR 11 21
HPS1* Hermansky-Pudlak syndrome AR 28 55
HPS3 Hermansky-Pudlak syndrome AR 10 17
HPS4 Hermansky-Pudlak syndrome AR 16 22
HPS5 Hermansky-Pudlak syndrome AR 20 31
HPS6 Hermansky-Pudlak syndrome AR 13 37
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
IFNGR2 Immunodeficiency AR 4 18
IKZF1 Immunodeficiency, common variable, 13 AD 10 35
ITK Lymphoproliferative syndrome AR 4 11
JAGN1 Neutropenia, severe congenital AR 8 8
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LAMTOR2 Immunodeficiency due to defect in MAPBP-interacting protein AR 1 1
LYST Chediak-Higashi syndrome AR 50 97
MAGT1 Immunodeficiency, with magnesium defect, Epstein-Barr virus infection and neoplasia, Mental retardation, X-linked 95 XL 8 14
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MKL1 Primary immunodeficiency AR 4
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
MYO5A Griscelli syndrome AR 7 9
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NHP2 Dyskeratosis congenita AR 5 3
NOP10 Dyskeratosis congenita AR 1 1
NRAS Noonan syndrome AD 31 14
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PGM3 Immunodeficiency 23 AR 14 15
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
RAB27A Griscelli syndrome, Elejalde syndrome AR 18 54
RAC2 Neutrophil immunodeficiency syndrome AD 2 3
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RBM8A* Thrombocytopenia - absent radius AD/AR 5 12
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
RIT1 Noonan syndrome AD 23 26
RPL11 Diamond-Blackfan anemia AD 12 45
RPL15* Diamond-Blackfan anemia AD 2 2
RPL27 Diamond-Blackfan anemia 16 1 1
RPL31 Diamond-Blackfan anemia AD 2
RPL35A Diamond-Blackfan anemia AD 7 14
RPL5 Diamond-Blackfan anemia AD 19 77
RPS10 Diamond-Blackfan anemia AD 3 5
RPS19 Diamond-Blackfan anemia AD 23 172
RPS24 Diamond-Blackfan anemia AD 6 10
RPS26 Diamond-Blackfan anemia AD 10 33
RPS28 Diamond-Blackfan anemia 15 with mandibulofacial dysostosis AD 1 1
RPS29 Diamond-Blackfan anemia AD 4 4
RPS7 Diamond-Blackfan anemia AD 2 10
RTEL1 Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis congenita AD/AR 58 51
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AD/AR 19 90
SH2D1A Lymphoproliferative syndrome XL 21 129
SLC37A4 Glycogen storage disease AR 49 113
SLX4 Fanconi anemia AR 18 72
SMARCD2 Specific granule defiency 2 AR 3 1
SOS1 Noonan syndrome AD 44 71
SRP54 Shwachman-Diamond syndrome AD 3
SRP72* Bone marrow failure syndrome 1 AD 2 5
STX11 Hemophagocytic lymphohistiocytosis, familial AR 8 22
STXBP2 Hemophagocytic lymphohistiocytosis, familial AR 12 77
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 42 73
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 48 156
THPO Thrombocythemia 1 AD 5 10
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
UBE2T Fanconi anemia, complementation group T AR 2 7
UNC13D Hemophagocytic lymphohistiocytosis, familial AR 22 192
USB1 Poikiloderma with neutropenia AR 24 22
VPS13B Cohen syndrome AR 351 203
VPS45# Neutropenia, severe congenital, 5, autosomal recessive AR 3 4
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich syndrome XL 57 439
WDR1 AR 8
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3
WRAP53 Dyskeratosis congenita AR 7 6
XIAP* Lymphoproliferative syndrome XL 14 96
XRCC2 Hereditary breast cancer AD/AR 10 21

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by Bone Marrow Failure Syndrome Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21972311 c.151-1104C>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
CTSC Chr11:88070895 c.-55C>A NM_001814.4 rs766114323
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCA Chr16:89864654 c.893+920C>A NM_000135.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCD2 Chr3:10102127 c.1766+40T>G NM_033084.3
FANCD2 Chr3:10106024 c.1948-16T>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
FANCL Chr2:58433394 c.375-2033C>G NM_001114636.1
FAS Chr10:90770494 c.506-16A>G NM_000043.4
FASLG Chr1:172628081 c.-261T>C NM_000639.1
GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GINS1 Chr20:25388397 c.-60A>G NM_021067.3
GINS1 Chr20:25388409 c.-48C>G NM_021067.3
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
LAMTOR2 Chr1:156028185 c.*23C>A NM_014017.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2 rs878853868
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
RPL31 Chr2:101618778 c.-1+1G>A NM_001098577.2
RPL5 Chr1:93300322 c.190-12_191dupCTCTTACTATAGAT NM_000969.3
RPS19 Chr19:42364214 c.-144_-141delTTTC NM_001022.3
RPS26 Chr12:56436176 c.4-25_4-14delTAACAGTTTTCC NM_001029.3
RPS7 Chr2:3622941 c.-19+1G>T NM_001011.3
RPS7 Chr2:3622942 c.-19+2T>C NM_001011.3
SH2D1A ChrX:123499593 c.138-17_138-11delAGTTTAT NM_002351.4
STX11 Chr6:144508713 c.*85_*86insT NM_003764.3
STXBP2 Chr19:7705761 c.326-23_326-16delGCCCCACT NM_006949.3
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
UNC13D Chr17:73826245 c.2831-13G>A NM_199242.2
UNC13D Chr17:73827442 c.2448-13G>A NM_199242.2 rs753762300
UNC13D Chr17:73839907 c.118-307G>A NM_199242.2
UNC13D Chr17:73839908 c.118-308C>T NM_199242.2
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2

Added and removed genes from the panel

Genes added Genes removed
DNASE2
EFL1
RPL27
RPL31
RPS28
SRP54
UBE2T

Test Strengths

The strengths of this test include:
  • CAP and ISO-15189 accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CSF2RA (NM_001161530:9), VPS45 (NM_001279353:13). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics bone marrow failure syndrome panel covers classical genes associated with Hermansky-Pudlak syndrome, Diamond-Blackfan anemia, Fanconi anemia, Wiskott-Aldrich syndrome, Bloom syndrome, ELANE-related neutropenia, Shwachman-Diamond syndrome, Inherited bone marrow failure syndrome, familial hemophagocytic lymphohistiocytosis, severe congenital neutropenia and dyskeratosis congenita. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999
Insertions, deletions and indels by sequence analysis
1-10 bps 96.9% (7,563/7,806) >99.9999
11-50 bps 99.13% (2,524/2,546) >99.9999
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
     
The performance presented above reached by WES with the following coverage metrics
     
Mean sequencing depth at exome level 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis is orthogonal confirmation. Sequence variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing when they do not meet our stringent NGS quality metrics for a true positive call.
Reported heterozygous and homo/hemizygous copy number variations with a size <10 and <3 target exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen and confirmed less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Subscribe to our newsletter