Blueprint Genetics / Tests / Panels / Hematology / Coagulation Factor Defic...

Coagulation Factor Deficiency Panel

Summary
  • Is a 16 gene panel that includes assessment of non-coding variants.

  • Is ideal for patients with a clinical suspicion of hemophilia A, hemophilia B, rare bleeding disorder or Von Willebrand disease. The genes on this panel are included in the Bleeding Disorder/Coagulopathy Panel and the Comprehensive Hematology Panel.

    Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions.

Analysis methods
  • PLUS
Availability

4 weeks

Number of genes

16

Test code

HE0501

Panel size

Small

CPT code *
81238, 81406, 81407, 81408, 81479
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Coagulation Factor Deficiency Panel (test code HE0501):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Coagulation Factor Deficiencies refers to a heterogenous group of inherited bleeding disorders. The most common coagulation factor deficiencies are hemophilias (A and B) and von Willebrand disease (VWD), together accounting for 95% of bleeding disorders. The clinical presentation of inherited bleeding disorders can be highly variable and the severity of the clinical manifestations depends on the biological activity of the coagulation factor. The diseases are characterized by abnormal bleeding of variable severity occurring either spontaneously or in association with trauma or an invasive procedure. The age of onset in hemophilia is typically in infancy. In VWD, the symptoms can begin at any age. Hemophilia A and B and are inherited in an X-linked recessive manner through mutations in the F8 and F9 genes, respectively. The diseases primarily affect males, but female carriers of the disease may have milder forms of the disease. VWD is inherited in both autosomal dominant and recessive manners and the causative gene is VWF. Rare bleeding disorders (RBDs) include inherited deficiencies of coagulation factors fibrinogen, factor (F)II, FV, combined FV and FVIII, FVII, FX, FXI, FXIII, and congenital deficiency of vitamin K-dependent factors (VKCFDs). RBDs are autosomal recessive conditions and deficiencies in FVII and FXI together account for 64% of cases (PMID: 25712993). The associated genes are FGA, FGB, FGG, F2, F5, F7, F10, F11, F13A1, LMAN1 and VKORC1. The prevalence of hemophilia is estimated at 1:12,000 and the prevalence of symptomatic VWD that requires specific treatment is estimated at between 1:50,000 and 1:8,500.

Genes in the Coagulation Factor Deficiency Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
F10 Factor X deficiency AR 15 155
F11 Factor XI deficiency AD/AR 77 271
F12 Angioedema, Factor XII deficiency AD/AR 7 53
F13A1 Factor XIIIA deficiency AR 20 180
F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, congenital AD/AR 14 66
F5 Factor V deficiency, Thrombophilia due to activated protein C resistance AD/AR 19 157
F7 Factor VII deficiency AR 27 322
F8* Hemophilia A XL 296 3205
F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX defect XL 117 1281
FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis AD/AR 10 144
FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital AD/AR 6 92
FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital AD/AR 7 127
GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation factor deficiency, Vitamin K-dependent clotting factors, combined deficiency AD/AR/Digenic 13 42
LMAN1 Combined factor V and VIII deficiency AR 5 37
VKORC1# Drug metabolism, VKORC1-related, Vitamin K-dependent clotting factors, combined deficiency AD/AR 4 27
VWF* Von Willebrand disease AD/AR 57 1009
*

Some, or all, of the gene is duplicated in the genome. Read more.

#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Coagulation Factor Deficiency Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
F11 Chr4:187186995 c.-456G>A NM_000128.3
F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853
F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976
F12 Chr5:176836590 NM_000505.3 rs187018744
F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3
F2 Chr11:46742048 c.241-25C>G NM_000506.3
F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963
F2 Chr11:46761064 c.*106T>A NM_000506.3
F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
F7 Chr13:113760060 c.-96C>T NM_000131.4
F7 Chr13:113760062 c.-94C>G NM_000131.4
F7 Chr13:113760091 c.-65G>C NM_000131.4
F7 Chr13:113760094 NM_000131.4
F7 Chr13:113760094 c.-62C>T NM_000131.4
F7 Chr13:113760095 c.-61T>G NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760097 c.-59T>G NM_000131.4
F7 Chr13:113760099 c.-57C>T NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666
F7 Chr13:113760117 c.-39A>G NM_000131.4
F7 Chr13:113760124 c.-32A>C NM_000131.4 rs761212787
F7 Chr13:113760126 c.-30A>C NM_000131.4 rs539578931
F7 Chr13:113764993 c.131-11G>A NM_000131.4
F7 Chr13:113766228 c.291+1065delC NM_000131.4
F7 Chr13:113770192 c.571+78G>A NM_000131.4 rs764741909
F7 Chr13:113771068 c.572-12T>A NM_000131.4
F8 ChrX:154084603 c.6900+4104A>T NM_000132.3
F8 ChrX:154091516 c.6430-14A>G NM_000132.3
F8 ChrX:154130453 c.5999-11G>A NM_000132.3 rs782132907
F8 ChrX:154130463 c.5999-23_5999-22delCT NM_000132.3
F8 ChrX:154130464 c.5999-33_5999-22delGAAATAATTTCTinsATTC NM_000132.3
F8 ChrX:154130469 c.5999-33_5999-28delGAAATA NM_000132.3
F8 ChrX:154130719 c.5999-277G>A NM_000132.3
F8 ChrX:154131240 c.5999-798G>A NM_000132.3
F8 ChrX:154132376 c.5816-14_5816-13delGTinsTA NM_000132.3
F8 ChrX:154132397 c.5816-34A>T NM_000132.3 rs782301004
F8 ChrX:154132892 c.5587-93C>T NM_000132.3
F8 ChrX:154134863 c.5220-16_5220-15insA NM_000132.3
F8 ChrX:154174820 c.2113+1152delA NM_000132.3
F8 ChrX:154175961 c.2113+12T>A NM_000132.3
F8 ChrX:154176219 c.1904-37G>A NM_000132.3 rs367615232
F8 ChrX:154185464 c.1538-18G>A NM_000132.3
F8 ChrX:154189025 c.1537+325A>G NM_000132.3
F8 ChrX:154189458 c.1444-15C>A NM_000132.3
F8 ChrX:154197841 c.788-14T>G NM_000132.3
F8 ChrX:154213089 c.671-11T>C NM_000132.3
F8 ChrX:154215591 c.602-11T>G NM_000132.3
F8 ChrX:154215612 c.602-32A>G NM_000132.3
F8 ChrX:154219579 c.601+1632G>A NM_000132.3 rs387906429
F8 ChrX:154221439 c.389-16T>G NM_000132.3
F8 ChrX:154227886 c.144-11T>G NM_000132.3
F8 ChrX:154227901 c.144-26A>T NM_000132.3
F8 ChrX:154238632 c.144-10758_144-10757insTATA NM_000132.3
F8 ChrX:154249118 c.143+1567A>G NM_000132.3
F8 ChrX:154250939 c.-112G>A NM_000132.3 rs1317271565
F8 ChrX:154251045 c.-218T>C NM_000132.3
F8 ChrX:154251045 NM_000132.3
F8 ChrX:154251046 c.-219C>T NM_000132.3
F8 ChrX:154251048 c.-221T>A NM_000132.3
F8 ChrX:154251082 c.-255A>G NM_000132.3
F8 ChrX:154251084 c.-257T>C/G NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251687 c.-860A>G NM_000132.3
F8 ChrX:154251793 c.-966G>T NM_000132.3
F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612871 c.-53A>G NM_000133.3
F9 ChrX:138612871 NM_000133.3
F9 ChrX:138612872 c.-52C>G/T NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612874 c.-50T>C/G NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612875 c.-49T>A/C NM_000133.3
F9 ChrX:138612875 NM_000133.3
F9 ChrX:138612875 NM_000133.3 rs1178811105
F9 ChrX:138612876 c.-48G>C NM_000133.3
F9 ChrX:138612886 c.-38A>G NM_000133.3
F9 ChrX:138612889 c.-35G>A/C NM_000133.3
F9 ChrX:138612889 NM_000133.3 rs1166164399
F9 ChrX:138612889 NM_000133.3
F9 ChrX:138612890 c.-34A>G/T NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612899 c.-22delT NM_000133.3
F9 ChrX:138612900 c.-24T>A NM_000133.3
F9 ChrX:138612901 c.-23T>C NM_000133.3
F9 ChrX:138612902 c.-22T>C NM_000133.3
F9 ChrX:138612903 c.-21C>G NM_000133.3
F9 ChrX:138612905 c.-19C>G NM_000133.3
F9 ChrX:138612905 c.-17delA NM_000133.3
F9 ChrX:138612906 c.-18A>G/T NM_000133.3
F9 ChrX:138612906 c.-18A>T NM_000133.3
F9 ChrX:138612906 c.-18A>G NM_000133.3
F9 ChrX:138612907 c.-17A>C/G NM_000133.3
F9 ChrX:138612907 c.-17A>C NM_000133.3
F9 ChrX:138612907 c.-17A>G NM_000133.3
F9 ChrX:138619496 c.253-25A>G/T NM_000133.3
F9 ChrX:138619496 c.253-25A>T NM_000133.3
F9 ChrX:138619496 c.253-25A>G NM_000133.3 rs1201753038
F9 ChrX:138619501 c.253-19_253-16delCTTC NM_000133.3
F9 ChrX:138619502 c.253-16_253-12delCTTTT NM_000133.3
F9 ChrX:138623222 c.278-13A>G NM_000133.3
F9 ChrX:138623223 c.278-12C>G/T NM_000133.3
F9 ChrX:138623223 c.278-12C>G NM_000133.3
F9 ChrX:138623223 c.278-12C>T NM_000133.3 rs1475223858
F9 ChrX:138630499 c.392-22_392-21delCT NM_000133.3
F9 ChrX:138630663 c.520+13A>G NM_000133.3
F9 ChrX:138633441 c.723+18T>A NM_000133.3
F9 ChrX:138645387 c.*1157A>G NM_000133.3
F9 ChrX:138645598 c.*1368A>G NM_000133.3
FGB Chr4:155486360 c.115-600A>G NM_005141.4
FGB Chr4:155490472 c.958+13C>T NM_005141.4 rs606231223
FGG Chr4:155527225 c.1129+632A>G NM_021870.2 rs2066862
FGG Chr4:155527787 c.1129+66_1129+69delAATA NM_021870.2 rs139788771
FGG Chr4:155530122 c.667-320A>T NM_021870.2
LMAN1 Chr18:57014710 c.822+34_822+35insGTTG NM_005570.3
VWF Chr12:6101204 c.6599-20A>T NM_000552.3 rs61750621
VWF Chr12:6125417 c.5312-19A>G NM_000552.3
VWF Chr12:6128923 c.3675-14G>A NM_000552.3
VWF Chr12:6233584 c.-1+3A>C NM_000552.3
VWF Chr12:6233714 c.-128G>A NM_000552.3 rs1300771136
VWF Chr12:6234258 c.-672C>T NM_000552.3 rs61750447

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

This NGS-based analysis does not include analysis of the intron 1 and intron 22 inversions in F8-gene. The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: VKORC1 (NM_001311311:3). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Seattle, WA, are equivalent.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Subscribe to our newsletter

Subscribe