- Is a 160 gene panel that includes assessment of non-coding variants.
Is ideal for patients with a clinical suspicion of inherited susceptibility to cancer. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.
- PLUS
4 weeks
160
ON1001
Large
** CPT coding is dependent on patient history and payer being billed.
Summary
The Blueprint Genetics Comprehensive Hereditary Cancer Panel (test code ON1001):
Test Specific Strength
Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.
ICD codes
Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient's name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
Hereditary cancer syndromes account for approximately 5-10% of all cancer. These cancers originate from the gastrointestinal tract, endocrine and neuroendocrine systems or from different organs like lung, kidneys, liver, pancreas, skin, and eyes. Hereditary cancer is suspected when there are multiple relatives on the same side of the family with the same or related forms of cancer, cancer at an early age or multiple primary cancers in an individual. The most common inherited cancer syndromes are hereditary breast and ovarian cancer syndrome, Lynch syndrome (also known as hereditary non-polyposis colorectal cancer), Li-Fraumeni syndrome, PTEN hamartoma tumor syndrome, familial adenomatous polyposis, Von-Hippel Lindau syndrome, and multiple endocrine neoplasia type 1 and type 2. Most of the hereditary cancer syndromes are inherited in an autosomal dominant manner and penetrance is high. Genetic testing is the most effective way to identify individuals with a genetic predisposition to develop cancer. Accurate genetic diagnosis enables personal cancer risk assessment and inherited genetic variant can be taken into account when planning the treatment and the follow-up of both unaffected and affected persons. In most of the cases, cancer mortality can be significantly reduced in high-risk individuals by regular surveillance and preventive strategies.
Genes in the Comprehensive Hereditary Cancer Panel and their clinical significance
Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
---|---|---|---|---|
AIP | Pituitary adenoma, familial isolated | AD | 53 | 110 |
ALK | Neuroblastoma | AD | 31 | 15 |
ANKRD26 | Thrombocytopenia | AD | 6 | 21 |
APC | Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis | AD | 773 | 1926 |
ATM | Breast cancer, Ataxia-Telangiectasia | AD/AR | 1047 | 1109 |
AXIN2 | Oligodontia-colorectal cancer syndrome, Oligondontia, isolated | AD | 19 | 18 |
BAP1 | Tumor predisposition syndrome | AD | 74 | 113 |
BARD1 | Breast cancer | AD | 159 | 114 |
BLM | Bloom syndrome | AR | 152 | 119 |
BMPR1A* | Polyposis, juvenile intestinal | AD | 110 | 140 |
BRAF* | LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome | AD | 134 | 65 |
BRCA1* | Pancreatic cancer, Breast-ovarian cancer, familial | AD | 2997 | 2631 |
BRCA2 | Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial | AD/AR | 3369 | 2659 |
BRIP1 | Fanconi anemia, Breast cancer | AD/AR | 238 | 189 |
BUB1B | Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait | AD/AR | 14 | 28 |
CBL | Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia | AD | 24 | 43 |
CD70 | Primary immunodeficiency | AR | 4 | |
CDC73 | Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome | AD | 50 | 101 |
CDH1 | CDH1-related cancer, Blepharocheilodontic syndrome 1 | AD | 178 | 242 |
CDK4 | Melanoma, cutaneous malignant | AD | 4 | 14 |
CDKN1B | Multiple endocrine neoplasia | AD | 13 | 20 |
CDKN1C | Beckwith-Wiedemann syndrome, IMAGE syndrome | AD | 35 | 81 |
CDKN2A | Melanoma, familial, Melanoma-pancreatic cancer syndrome | AD | 87 | 232 |
CEBPA | Acute myeloid leukemia, familial | AD | 15 | 13 |
CEP57 | Mosaic variegated aneuploidy syndrome | AR | 5 | 5 |
CHEK2* | Li-Fraumeni syndrome | AD/AR | 275 | 197 |
CTNNA1 | Macular dystrophy, patterned 2 | AD | 6 | 10 |
CYLD | Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis | AD | 34 | 106 |
DDB2 | Xeroderma pigmentosum | AR | 4 | 17 |
DDX41 | Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to | AD | 9 | 21 |
DICER1* | DICER1 syndrome | AD | 197 | 137 |
DIS3L2* | Perlman syndrome | AR | 12 | 14 |
DKC1 | Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita | XL | 48 | 74 |
EFL1* | Shwachman-Diamond syndrome | 3 | 2 | |
EGFR | Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial | AD/AR | 55 | 18 |
ELANE | Neutropenia | AD | 43 | 217 |
EPCAM | Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis | AD/AR | 38 | 80 |
ERCC1 | Cerebrooculofacioskeletal syndrome 4 | AR | 8 | 5 |
ERCC2 | Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 | AR | 26 | 98 |
ERCC3 | Xeroderma pigmentosum, Trichothiodystrophy, photosensitive | AR | 10 | 19 |
ERCC4 | Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome | AR | 13 | 70 |
ERCC5 | Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome | AR | 21 | 54 |
ETV6 | Thrombocytopenia 5 | AD | 10 | 38 |
EXO1 | Lynch syndrome | AD/AR | 1 | 14 |
EXT1 | Multiple cartilagenious exostoses 1 | AD | 97 | 523 |
EXT2 | Multiple cartilagenious exostoses 2, Seizures, scoliosis, and macrocephaly syndrome | AD/AR | 45 | 250 |
EZH2 | Weaver syndrome | AD | 29 | 41 |
FAM111B* | Hereditary Fibrosing Poikiloderma with Tendon Contracture, Myopathy, and Pulmonary Fibrosis, Lung cancer, familial, susceptibilty to | AD | 7 | 7 |
FANCA | Fanconi anemia | AR | 191 | 677 |
FANCB | Fanconi anemia | XL | 11 | 21 |
FANCC | Fanconi anemia | AR | 94 | 64 |
FANCD2* | Fanconi anemia | AR | 21 | 61 |
FANCE | Fanconi anemia | AR | 4 | 17 |
FANCF | Fanconia anemia | AR | 7 | 16 |
FANCG | Fanconi anemia | AR | 16 | 92 |
FANCI | Fanconi anemia | AR | 13 | 45 |
FANCL | Fanconi anemia | AR | 13 | 24 |
FANCM | Fanconi anemia | AR | 6 | 50 |
FH | Hereditary leiomyomatosis and renal cell cancer | AD/AR | 178 | 207 |
FLCN | Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous | AD | 154 | 210 |
GALNT12 | Colorectal cancer, susceptibility to, 1, Inflammatory bowel disease | AD | 8 | |
GATA2 | Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency | AD | 30 | 142 |
GPC3 | Simpson-Golabi-Behmel syndrome | XL | 33 | 75 |
GPR101 | Pituitary adenoma, growth hormone secreting, 2 | XL | 17 | |
GREM1 | Hereditary mixed polyposis syndrome | AD/AR | 1 | 8 |
HAVCR2 | ||||
HNF1A | Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis | AD | 78 | 528 |
HOXB13 | Familial prostate cancer | AD/AR | 1 | 5 |
HRAS | Costello syndrome, Congenital myopathy with excess of muscle spindles | AD | 43 | 31 |
IKZF1 | Immunodeficiency, common variable, 13 | AD | 10 | 35 |
KIF1B | Pheochromocytoma, Neuroblastoma, Charcot-Marie-Tooth disease, type 2A1 | AD | 7 | 12 |
KIT | Gastrointestinal stromal tumor, Piebaldism | AD | 79 | 116 |
KITLG | Hyperpigmentation with or without hypopigementation, familial progressive, Skin/hair/eye pigmentation, variation in, 7 | AD | 6 | 10 |
KRAS* | Noonan syndrome, Cardiofaciocutaneous syndrome | AD | 63 | 35 |
LZTR1 | Schwannomatosis, Noonan syndrome | AD/AR | 34 | 71 |
MAP2K1 | Cardiofaciocutaneous syndrome | AD | 45 | 23 |
MAP2K2 | Cardiofaciocutaneous syndrome | AD | 21 | 35 |
MAX | Pheochromocytoma | AD | 13 | 31 |
MEN1 | Hyperparathyroidism, familial primary, Multiple endocrine neoplasia | AD | 263 | 730 |
MET | Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to | AD/AR | 20 | 34 |
MITF | Tietz albinism-deafness syndrome, Waardenburg syndrome, Coloboma, osteopetrosis, microphthalmia, macrocephaly, albinism, and deafness (COMMAD) | AD/AR | 32 | 58 |
MLH1 | Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 873 | 1191 |
MLH3 | Colorectal cancer, hereditary nonpolyposis, Endometrial carcinoma | AD/AR | 7 | 31 |
MRE11A | Ataxia-telangiectasia-like disorder-1 | AR | 57 | 56 |
MSH2 | Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome | AD/AR | 933 | 1249 |
MSH3 | Endometrial carcinoma, Colorectal adenomatous polyposis, autosomal recessive, with pilomatricomas | AD | 4 | 22 |
MSH6 | Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 672 | 586 |
MUTYH | Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas | AR | 134 | 168 |
NBN | Breast cancer, Nijmegen breakage syndrome | AD/AR | 188 | 97 |
NF1* | Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome | AD | 1157 | 2901 |
NF2 | Schwannomatosis, Neurofibromatosis | AD | 66 | 433 |
NRAS | Noonan syndrome | AD | 31 | 14 |
NSD1 | Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome | AD | 329 | 517 |
NSUN2 | Dubowitz syndrome, Non-syndromic intellectual disability | AR | 8 | 7 |
NTHL1 | Familial adenomatous polyposis 3 | AR | 7 | 3 |
PALB2 | Fanconi anemia, Pancreatic cancer, Breast cancer | AD/AR | 495 | 406 |
PAX5 | Pre-B cell acute lymphoblastic leukemia | AD | 7 | |
PDGFRA# | Gastrointestinal stromal tumor | AD | 22 | 19 |
PHOX2B | Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease | AD | 11 | 86 |
PMS1# | Hereditary nonpolyposis colon cancer | AD/AR | 1 | 32 |
PMS2* | Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis | AD/AR | 319 | 342 |
POLD1 | Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, Idiopathic bronchiectasis, Immunodeficiency | AD/AR | 3 | 31 |
POLE | Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) | AD/AR | 8 | 70 |
POLH* | Xeroderma pigmentosum, variant type | AR | 20 | 78 |
POT1 | Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 | AD | 2 | 34 |
PPM1D | Hereditary breast cancer | AD | 16 | 60 |
PRF1 | Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis | AR | 24 | 183 |
PRKAR1A | Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex | AD | 75 | 183 |
PTCH1 | Basal cell nevus syndrome | AD | 193 | 522 |
PTEN* | Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome | AD | 435 | 638 |
PTPN11 | Noonan syndrome, Metachondromatosis | AD | 135 | 140 |
RAD50 | Breast cancer, Nijmegen breakage syndrome-like disorder | AD/AR | 183 | 88 |
RAD51C | Fanconi anemia, Breast-ovarian cancer, familial | AD/AR | 107 | 125 |
RAD51D | Ovarian cancer, familial | AD | 77 | 78 |
RAF1 | LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) | AD | 45 | 53 |
RASA2 | Noonan syndrome | AD | 1 | 3 |
RB1 | Retinoblastoma | AD | 266 | 1102 |
RECQL* | Breast cancer | AD | 9 | 27 |
RECQL4 | Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome | AR | 82 | 114 |
REST | Fibromatosis, gingival, 5 | AD | 3 | 16 |
RET | Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia | AD/AR | 122 | 407 |
RHBDF2 | Tylosis with esophageal cancer | AD | 2 | 4 |
RIT1 | Noonan syndrome | AD | 23 | 26 |
RPS20 | Colorectal cancer | AD | 1 | |
RRAS | Noonan-syndrome like phenotype | AD/AR | 2 | |
RUNX1 | Platelet disorder, familial, with associated myeloid malignancy | AD | 47 | 101 |
SAMD9 | Mirage syndrome, Tumoral calcinosis, normophosphatemic | AD/AR | 10 | 27 |
SAMD9L | Ataxia-pancytopenia syndrome | AD | 4 | 16 |
SBDS* | Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia | AR | 19 | 90 |
SDHA* | Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG | AD/AR | 54 | 87 |
SDHAF2 | Paragangliomas | AD | 4 | 5 |
SDHB | Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome | AD | 151 | 272 |
SDHC | Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas | AD | 29 | 60 |
SDHD# | Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency | AD | 68 | 170 |
SHOC2 | Noonan-like syndrome with loose anagen hair | AD | 2 | 4 |
SLX4 | Fanconi anemia | AR | 18 | 72 |
SMAD4 | Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia | AD | 179 | 143 |
SMARCA4 | Rhabdoid tumor predisposition syndrome | AD | 76 | 57 |
SMARCB1 | Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 | AD | 36 | 118 |
SMARCE1 | Coffin-Siris syndrome | AD | 14 | 12 |
SOS1 | Noonan syndrome | AD | 44 | 71 |
SOS2 | Noonan syndrome 9 | AD | 4 | 6 |
SPRED1 | Legius syndrome | AD | 38 | 71 |
SRP72* | Bone marrow failure syndrome 1 | AD | 2 | 5 |
STK11 | Peutz-Jeghers syndrome | AD | 173 | 460 |
SUFU | Medulloblastoma, Basal cell nevus syndrome | AD | 22 | 44 |
TERC | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD | 42 | 73 |
TERT | Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita | AD/AR | 48 | 156 |
TINF2 | Revesz syndrome, Dyskeratosis congenita | AD | 25 | 42 |
TMEM127 | Pheochromocytoma | AD | 30 | 52 |
TP53 | Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma | AD | 393 | 505 |
TRIP13 | Mosaic variegated aneuploidy syndrome 3 | 2 | 2 | |
TSC1 | Lymphangioleiomyomatosis, Tuberous sclerosis | AD | 177 | 372 |
TSC2 | Lymphangioleiomyomatosis, Tuberous sclerosis | AD | 396 | 1195 |
VHL | Erythrocytosis, familial, Pheochromocytoma | AD/AR | 206 | 614 |
WRN* | Werner syndrome | AR | 64 | 107 |
WT1 | Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 | AD | 42 | 183 |
XPA | Xeroderma pigmentosum | AR | 49 | 47 |
XPC | Xeroderma pigmentosum | AR | 67 | 91 |
XRCC2 | Hereditary breast cancer | AD/AR | 10 | 21 |
* Some, or all, of the gene is duplicated in the genome. Read more.
# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Comprehensive Hereditary Cancer Panel
Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
---|---|---|---|---|
AIP | Chr11:67250360 | NM_003977.2 | rs267606588 | |
AIP | Chr11:67250410 | c.-220G>A | NM_003977.2 | rs267606540 |
ANKRD26 | Chr10:27389371 | c.-116C>G | NM_014915.2 | |
ANKRD26 | Chr10:27389373 | c.-118C>A | NM_014915.2 | |
ANKRD26 | Chr10:27389374 | c.-119C>A | NM_014915.2 | |
ANKRD26 | Chr10:27389374 | c.-119C>A/G | NM_014915.2 | |
ANKRD26 | Chr10:27389376 | c.-121A>C | NM_014915.2 | |
ANKRD26 | Chr10:27389380 | c.-127_-126delAT | NM_014915.2 | |
ANKRD26 | Chr10:27389381 | c.-126T>C | NM_014915.2 | |
ANKRD26 | Chr10:27389381 | c.-126T>G | NM_014915.2 | |
ANKRD26 | Chr10:27389382 | c.-127A>G | NM_014915.2 | |
ANKRD26 | Chr10:27389382 | c.-127A>T | NM_014915.2 | |
ANKRD26 | Chr10:27389383 | c.-128G>T | NM_014915.2 | |
ANKRD26 | Chr10:27389383 | c.-128G>A | NM_014915.2 | |
ANKRD26 | Chr10:27389383 | c.-128G>C | NM_014915.2 | |
ANKRD26 | Chr10:27389389 | c.-134G>A | NM_014915.2 | rs863223318 |
APC | Chr5:112043009–112043595 | |||
APC | Chr5:112043220 | c.-195A>C | NM_001127511.2 | |
APC | Chr5:112043223 | c.-192A>G/T | NM_001127511.2 | |
APC | Chr5:112043223 | c.-192A>G | NM_001127511.2 | rs879253784 |
APC | Chr5:112043223 | c.-192A>T | NM_001127511.2 | |
APC | Chr5:112043224 | c.-191T>C | NM_001127511.2 | |
APC | Chr5:112043225 | c.-190G>A | NM_001127511.2 | |
APC | Chr5:112043289 | c.-125delA | NM_001127511.2 | |
APC | Chr5:112072710–112073585 | |||
APC | Chr5:112111314 | c.423-12A>G | NM_000038.5 | |
APC | Chr5:112111315 | c.423-11A>G | NM_000038.5 | |
APC | Chr5:112115546 | c.532-941G>A | NM_000038.5 | rs730881227 |
APC | Chr5:112151175 | c.835-17A>G | NM_000038.5 | |
APC | Chr5:112158419 | c.1408+731C>T | NM_000038.5 | |
APC | Chr5:112158423 | c.1408+735A>T | NM_000038.5 | |
ATM | Chr11:108093770 | c.-174A>G | NM_000051.3 | |
ATM | Chr11:108094508 | c.-31+595G>A | NM_000051.3 | |
ATM | Chr11:108098321 | c.-30-1G>T | NM_000051.3 | rs869312754 |
ATM | Chr11:108138753 | c.2639-384A>G | NM_000051.3 | |
ATM | Chr11:108141209 | c.2839-579_2839-576delAAGT | NM_000051.3 | |
ATM | Chr11:108151710 | c.3403-12T>A | NM_000051.3 | rs201370733 |
ATM | Chr11:108158168 | c.3994-159A>G | NM_000051.3 | rs864622543 |
ATM | Chr11:108164028 | c.4612-12A>G | NM_000051.3 | |
ATM | Chr11:108179837 | c.5763-1050A>G | NM_000051.3 | rs774925473 |
ATM | Chr11:108214779 | c.8418+681A>G | NM_000051.3 | rs748635985 |
BAP1 | Chr3:52435659 | c.*644delG | NM_004656.3 | |
BRCA1 | Chr17:41196352 | c.*1340_*1342delTGT | NM_007294.3 | rs1281551853 |
BRCA1 | Chr17:41196424 | c.*1271T>C | NM_007294.3 | |
BRCA1 | Chr17:41197167 | c.*528G>C | NM_007294.3 | rs1060504556 |
BRCA1 | Chr17:41197588 | c.*103_*106delTGTC | NM_007294.3 | rs431825382 |
BRCA1 | Chr17:41197637 | c.*58C>T | NM_007294.3 | rs137892861 |
BRCA1 | Chr17:41197859 | c.5468-40T>A | NM_007294.3 | rs80358151 |
BRCA1 | Chr17:41199745 | c.5407-25T>A | NM_007294.3 | rs758780152 |
BRCA1 | Chr17:41201232 | c.5333-36_5333-22delTACTGCAGTGATTTT | NM_007294.3 | |
BRCA1 | Chr17:41206122 | c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG | NM_007294.3 | |
BRCA1 | Chr17:41209164 | c.5194-12G>A | NM_007294.3 | rs80358079 |
BRCA1 | Chr17:41215994 | c.5075-27delA | NM_007294.3 | |
BRCA1 | Chr17:41251909 | c.442-22_442-13delTGTTCTTTAC | NM_007294.3 | rs879254224 |
BRCA1 | Chr17:41256984 | c.213-11T>G | NM_007294.3 | rs80358061 |
BRCA1 | Chr17:41256985 | c.213-12A>G | NM_007294.3 | rs80358163 |
BRCA1 | Chr17:41256988 | c.213-15A>G | NM_007294.3 | |
BRCA1 | Chr17:41276134 | c.-19-2A>G | NM_007294.3 | |
BRCA2 | Chr13:32889805 | c.-40+1G>A | NM_000059.3 | |
BRCA2 | Chr13:32890469 | c.-39-89delC | NM_000059.3 | |
BRCA2 | Chr13:32890556 | c.-39-1_-39delGA | NM_000059.3 | rs758732038 |
BRCA2 | Chr13:32890558 | c.-39-1G>A | NM_000059.3 | rs1060499566 |
BRCA2 | Chr13:32900222 | c.426-12_426-8delGTTTT | NM_000059.3 | rs276174844 |
BRCA2 | Chr13:32945079 | c.8488-14A>G | NM_000059.3 | |
BRCA2 | Chr13:32953872 | c.8954-15T>G | NM_000059.3 | |
BRCA2 | Chr13:32971007 | c.9502-28A>G | NM_000059.3 | rs397508059 |
BRCA2 | Chr13:32971023 | c.9502-12T>G | NM_000059.3 | rs81002803 |
BRIP1 | Chr17:59858864 | c.1629-498A>T | NM_032043.2 | |
BUB1B | Chr15:40409289 | c.-44133G>A | NM_001211.5 | rs576524605 |
BUB1B | Chr15:40504689 | c.2386-11A>G | NM_001211.5 | rs751421137 |
CDH1 | Chr16:68842843 | c.687+92T>A | NM_004360.3 | |
CDKN1B | Chr12:12870317 | c.-454_-451delTTCC | NM_004064.3 | rs786201010 |
CDKN1C | Chr11:2905209 | c.*5+20G>T | NM_000076.2 | rs760540648 |
CDKN2A | Chr9:21968346 | c.458-105A>G | NM_000077.4 | |
CDKN2A | Chr9:21972311 | c.151-1104C>G | NM_000077.4 | |
CDKN2A | Chr9:21973573 | c.150+1104C>A | NM_000077.4 | rs756102261 |
CDKN2A | Chr9:21974401 | c.*73+2T>G | NM_058197.4 | |
CDKN2A | Chr9:21974847 | c.-21C>T | NM_000077.4 | |
CDKN2A | Chr9:21974875 | c.-49C>A | NM_000077.4 | rs1064797383 |
CDKN2A | Chr9:21974882 | c.-56G>T | NM_000077.4 | |
CDKN2A | Chr9:21974916 | c.-93_-91delAGG | NM_000077.4 | |
CYLD | Chr16:50813428 | c.1139-148A>G | NM_015247.2 | |
DICER1 | Chr14:95559038 | c.5364+1187T>G | NM_177438.2 | |
DKC1 | ChrX:153991099 | c.-142C>G | NM_001363.3 | rs199422241 |
DKC1 | ChrX:153991100 | c.-141C>G | NM_001363.3 | |
DKC1 | ChrX:153993704 | c.85-15T>C | NM_001363.3 | |
EPCAM | Chr2:47606078 | c.556-14A>G | NM_002354.2 | rs376155665 |
ERCC1 | Chr19:45918244 | c.603-26G>A | NM_202001.2 | rs367887072 |
ERCC5 | Chr13:103514354 | c.881-26T>G | NM_000123.3 | |
FANCA | Chr16:89805127 | c.4261-19_4261-12delACCTGCTC | NM_000135.3 | |
FANCA | Chr16:89816056 | c.3239+82T>G | NM_000135.2 | |
FANCA | Chr16:89818822 | c.2982-192A>G | NM_000135.2 | |
FANCA | Chr16:89831215 | c.2778+83C>G | NM_000135.2 | rs750997715 |
FANCA | Chr16:89836111 | c.2504+134A>G | NM_000135.2 | |
FANCA | Chr16:89836805 | c.2223-138A>G | NM_000135.2 | |
FANCA | Chr16:89849346 | c.1567-20A>G | NM_000135.2 | rs775154397 |
FANCA | Chr16:89864654 | c.893+920C>A | NM_000135.2 | |
FANCC | Chr9:98011653 | c.-78-2A>G | NM_000136.2 | rs587779898 |
FANCC | Chr9:98079807 | c.-79+1G>A | NM_000136.2 | |
FANCD2 | Chr3:10083186 | c.696-121C>G | NM_033084.3 | |
FANCD2 | Chr3:10102127 | c.1766+40T>G | NM_033084.3 | |
FANCD2 | Chr3:10106024 | c.1948-16T>G | NM_033084.3 | |
FANCI | Chr15:89825208 | c.1583+142C>T | NM_001113378.1 | |
FANCL | Chr2:58433394 | c.375-2033C>G | NM_001114636.1 | |
GATA2 | Chr3:128202131 | c.1017+572C>T | NM_032638.4 | |
GATA2 | Chr3:128202162 | c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC | NM_032638.4 | |
GATA2 | Chr3:128202171 | c.1017+532T>A | NM_032638.4 | |
HNF1A | Chr12:121416034 | c.-538G>C | NM_000545.5 | |
HNF1A | Chr12:121416110 | c.-462G>A | NM_000545.5 | |
HNF1A | Chr12:121416281 | c.-291T>C | NM_000545.5 | rs534474388 |
HNF1A | Chr12:121416285 | c.-287G>A | NM_000545.5 | |
HNF1A | Chr12:121416285 | NM_000545.5 | ||
HNF1A | Chr12:121416289 | c.-283A>C | NM_000545.5 | |
HNF1A | Chr12:121416314 | c.-258A>G | NM_000545.5 | rs756136537 |
HNF1A | Chr12:121416354 | c.-218T>C | NM_000545.5 | |
HNF1A | Chr12:121416385 | c.-187C>A/T | NM_000545.5 | |
HNF1A | Chr12:121416385 | NM_000545.5 | ||
HNF1A | Chr12:121416385 | NM_000545.5 | rs970766228 | |
HNF1A | Chr12:121416391 | NM_000545.5 | ||
HNF1A | Chr12:121416437 | NM_000545.5 | ||
HNF1A | Chr12:121416446 | NM_000545.5 | rs780586155 | |
HNF1A | Chr12:121416453 | c.-119G>A | NM_000545.5 | rs371945966 |
HNF1A | Chr12:121416475 | c.-97T>G | NM_000545.5 | |
HNF1A | Chr12:121416508 | NM_000545.5 | ||
LZTR1 | Chr22:21336623 | c.-38T>A | NM_006767.3 | |
LZTR1 | Chr22:21350968 | c.2220-17C>A | NM_006767.3 | rs1249726034 |
MEN1 | Chr11:64571394 | c.*412G>A | NM_000244.3 | |
MEN1 | Chr11:64575165 | c.670-15_670-14delTC | NM_000244.3 | |
MEN1 | Chr11:64577602 | c.-23-11_-22delTTGCCTTGCAGGC | NM_000244.3 | |
MEN1 | Chr11:64577603 | c.-23_-22insT | NM_000244.3 | |
MEN1 | Chr11:64577626 | c.-23-22C>A | NM_000244.3 | |
MLH1 | Chr3:37034619 | c.-413_-411delGAG | NM_000249.3 | rs953169437 |
MLH1 | Chr3:37034932 | c.-107C>G | NM_000249.3 | rs587778886 |
MLH1 | Chr3:37034976 | c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA | NM_000249.3 | |
MLH1 | Chr3:37034997 | c.-42C>T | NM_000249.3 | rs41285097 |
MLH1 | Chr3:37035012 | c.-27C>A | NM_000249.3 | rs587779001 |
MLH1 | Chr3:37035260 | c.116+106G>A | NM_000249.3 | |
MLH1 | Chr3:37038099 | c.117-11T>A | NM_000249.3 | rs267607711 |
MLH1 | Chr3:37050292 | c.454-13A>G | NM_000249.3 | rs267607749 |
MLH1 | Chr3:37061788 | c.885-9_887dupTCCTGACAGTTT | NM_000249.3 | rs63751620 |
MLH1 | Chr3:37070436 | c.1558+13T>A | NM_000249.3 | rs267607834 |
MSH2 | Chr2:47630106 | c.-225G>C | NM_000251.2 | rs138068023 |
MSH2 | Chr2:47630150 | c.-181G>A | NM_000251.2 | rs786201698 |
MSH2 | Chr2:47630249 | c.-81dupA | NM_000251.2 | rs560991330,rs587779187 |
MSH2 | Chr2:47630251 | c.-78_-77delTG | NM_000251.2 | rs587779182 |
MSH2 | Chr2:47698086 | c.1662-17dupG | NM_000251.2 | rs587779099 |
MSH6 | Chr2:48018295 | c.457+33_457+34insGTGT | NM_000179.2 | |
MSH6 | Chr2:48030536 | c.3173-16_3173-5delCCCTCTCTTTTA | NM_000179.2 | |
MSH6 | Chr2:48034014 | c.*15A>C | NM_000179.2 | |
MSH6 | Chr2:48034047 | c.*49_*68dupTTCAGACAACATTATGATCT | NM_000179.2 | rs777409019 |
MUTYH | Chr1:45797534 | c.998-13T>G | NM_001128425.1 | |
MUTYH | Chr1:45798558 | c.504+19_504+31delTAGGGGAAATAGG | NM_001128425.1 | rs781222233 |
NF1 | Chr17:29422055 | c.-273A>C | NM_001042492.2 | |
NF1 | Chr17:29422056 | c.-272G>A | NM_001042492.2 | |
NF1 | Chr17:29431417 | c.60+9031_60+9035delAAGTT | NM_001042492.2 | |
NF1 | Chr17:29475515 | c.61-7486G>T | NM_001042492.2 | |
NF1 | Chr17:29488136 | c.288+2025T>G | NM_001042492.2 | |
NF1 | Chr17:29508426 | c.587-14T>A | NM_001042492.2 | |
NF1 | Chr17:29508428 | c.587-12T>A | NM_001042492.2 | |
NF1 | Chr17:29510334 | c.888+651T>A | NM_001042492.2 | |
NF1 | Chr17:29510427 | c.888+744A>G | NM_001042492.2 | |
NF1 | Chr17:29510472 | c.888+789A>G | NM_001042492.2 | |
NF1 | Chr17:29527428 | c.889-12T>A | NM_001042492.2 | |
NF1 | Chr17:29530107 | c.1260+1604A>G | NM_001042492.2 | |
NF1 | Chr17:29533239 | c.1261-19G>A | NM_001042492.2 | |
NF1 | Chr17:29534143 | c.1392+754T>G | NM_001042492.2 | |
NF1 | Chr17:29540877 | c.1393-592A>G | NM_001042492.2 | |
NF1 | Chr17:29542762 | c.1527+1159C>T | NM_001042492.2 | |
NF1 | Chr17:29548419 | c.1642-449A>G | NM_001042492.2 | rs863224655 |
NF1 | Chr17:29549489 | c.*481A>G | NM_001128147.2 | |
NF1 | Chr17:29553439 | c.2002-14C>G | NM_001042492.2 | |
NF1 | Chr17:29554225 | c.2252-11T>G | NM_001042492.2 | |
NF1 | Chr17:29556025 | c.2410-18C>G | NM_001042492.2 | |
NF1 | Chr17:29556027 | c.2410-16A>G | NM_001042492.2 | |
NF1 | Chr17:29556028 | c.2410-15A>G | NM_001042492.2 | |
NF1 | Chr17:29556031 | c.2410-12T>G | NM_001042492.2 | |
NF1 | Chr17:29556839 | c.2851-14_2851-13insA | NM_001042492.2 | |
NF1 | Chr17:29557267 | c.2991-11T>G | NM_001042492.2 | |
NF1 | Chr17:29558777 | c.3198-314G>A | NM_001042492.2 | |
NF1 | Chr17:29563299 | c.3974+260T>G | NM_001042492.2 | |
NF1 | Chr17:29577082 | c.4110+945A>G | NM_001042492.2 | |
NF1 | Chr17:29580296 | c.4173+278A>G | NM_001042492.2 | |
NF1 | Chr17:29588708 | c.4578-20_4578-18delAAG | NM_001042492.2 | |
NF1 | Chr17:29588715 | c.4578-14T>G | NM_001042492.2 | |
NF1 | Chr17:29654479 | c.5269-38A>G | NM_001042492.2 | |
NF1 | Chr17:29656858 | c.5610-456G>T | NM_001042492.2 | |
NF1 | Chr17:29657848 | c.5812+332A>G | NM_001042492.2 | rs863224491 |
NF1 | Chr17:29661577 | c.5813-279A>G | NM_001042492.2 | |
NF1 | Chr17:29664375 | c.6428-11T>G | NM_001042492.2 | |
NF1 | Chr17:29664618 | c.6642+18A>G | NM_001042492.2 | |
NF1 | Chr17:29676126 | c.7190-12T>A | NM_001042492.2 | |
NF1 | Chr17:29676127 | c.7190-11_7190-10insGTTT | NM_001042492.2 | |
NF1 | Chr17:29685177 | c.7971-321C>G | NM_001042492.2 | |
NF1 | Chr17:29685481 | c.7971-17C>G | NM_001042492.2 | |
NF1 | Chr17:29685665 | c.8113+25A>T | NM_001042492.2 | |
NF2 | Chr22:30050946 | c.516+232G>A | NM_000268.3 | |
NSUN2 | Chr5:6622224 | c.538-11T>G | NM_017755.5 | |
PALB2 | Chr16:23649285 | c.109-12T>A | NM_024675.3 | rs774949203 |
PDGFRA | Chr4:55161473 | c.*34G>A | NM_006206.4 | rs552950826 |
PMS2 | Chr7:6027263 | c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC | NM_000535.5 | rs751973268 |
PMS2 | Chr7:6048599 | c.23+21_23+28delTCCGGTGT | NM_000535.5 | |
POLE | Chr12:133249181 | c.1686+32C>G | NM_006231.2 | rs762985435 |
POLH | Chr6:43544178 | c.-5+1G>C | NM_006502.2 | |
PRKAR1A | Chr17:66508599 | c.-97G>A | NM_002734.4 | |
PRKAR1A | Chr17:66508689 | c.-7G>A | NM_002734.4 | |
PRKAR1A | Chr17:66508690 | c.-7+1G>A | NM_002734.4 | |
PRKAR1A | Chr17:66521878 | c.550-17T>A | NM_002734.4 | |
PRKAR1A | Chr17:66523964 | c.709-7_709-2delTTTTTA | NM_002734.4 | rs281864801 |
PTCH1 | Chr9:98226337 | c.2561-2057A>G | NM_000264.3 | |
PTEN | Chr10:89622883–89623482 | |||
PTEN | Chr10:89622988 | c.-1239A>G | NM_000314.6 | |
PTEN | Chr10:89623049 | c.-1178C>T | NM_000314.6 | |
PTEN | Chr10:89623056 | c.-1171C>T | NM_000314.6 | rs587779981 |
PTEN | Chr10:89623116 | c.-1111A>G | NM_000314.6 | |
PTEN | Chr10:89623226 | c.-1001T>C | NM_000314.4 | |
PTEN | Chr10:89623296 | c.-931G>A | NM_000314.4 | rs587781959 |
PTEN | Chr10:89623306 | c.-921G>T | NM_000314.4 | |
PTEN | Chr10:89623331 | c.-896T>C | NM_000314.4 | |
PTEN | Chr10:89623365 | c.-862G>T | NM_000314.4 | rs587776675 |
PTEN | Chr10:89623373 | c.-854C>G | NM_000314.4 | |
PTEN | Chr10:89623392 | c.-835C>T | NM_000314.4 | rs587779994 |
PTEN | Chr10:89623428 | c.-799G>C | NM_000314.4 | rs587779992 |
PTEN | Chr10:89623462 | c.-765G>A | NM_000314.4 | |
PTEN | Chr10:89690791 | c.210-8dupT | NM_000314.4 | |
PTEN | Chr10:89692749 | c.254-21G>C | NM_000314.4 | |
PTEN | Chr10:89725294 | c.*65T>A | NM_000314.4 | |
PTEN | Chr10:89725304 | c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG | NM_000314.4 | |
PTPN11 | Chr12:112915602 | c.934-59T>A | NM_002834.3 | |
RB1 | Chr13:48877814 | NM_000321.2 | rs576931877 | |
RB1 | Chr13:48877836 | NM_000321.2 | ||
RB1 | Chr13:48877837 | c.-212G>A | NM_000321.2 | |
RB1 | Chr13:48877851 | c.-198G>A | NM_000321.2 | rs387906521 |
RB1 | Chr13:48877851 | c.-198G>T | NM_000321.2 | |
RB1 | Chr13:48877852 | c.-197G>A | NM_000321.2 | |
RB1 | Chr13:48877853 | NM_000321.2 | ||
RB1 | Chr13:48877856 | c.-193T>A/G | NM_000321.2 | |
RB1 | Chr13:48877856 | NM_000321.2 | ||
RB1 | Chr13:48877856 | NM_000321.2 | ||
RB1 | Chr13:48877857 | c.-192G>A | NM_000321.2 | |
RB1 | Chr13:48877860 | c.-189G>T | NM_000321.2 | rs387906520 |
RB1 | Chr13:48877899 | c.-150G>C | NM_000321.2 | |
RB1 | Chr13:48877900 | c.-149G>T | NM_000321.2 | |
RB1 | Chr13:48921946 | c.501-15T>G | NM_000321.2 | |
RB1 | Chr13:48930735 | c.608-3418A>G | NM_000321.2 | |
RB1 | Chr13:48937921 | c.861+828T>G | NM_000321.2 | |
RB1 | Chr13:48947691 | c.1215+63T>G | NM_000321.2 | |
RB1 | Chr13:48954175 | c.1390-14A>G | NM_000321.2 | rs9535023 |
RB1 | Chr13:48954239 | c.1421+20_1421+33delTAAAAAATTTTTTT | NM_000321.2 | |
RB1 | Chr13:49027115 | c.1696-14C>T | NM_000321.2 | rs776912915 |
RB1 | Chr13:49027117 | c.1696-12T>G | NM_000321.2 | |
RB1 | Chr13:49030329 | c.1815-11A>G | NM_000321.2 | |
RB1 | Chr13:49039121 | c.2212-13T>A | NM_000321.2 | |
RB1 | Chr13:49039327 | c.2326-14T>C | NM_000321.2 | |
RB1 | Chr13:49046098 | c.2490-1398A>G | NM_000321.2 | |
RB1 | Chr13:49047468 | c.2490-28T>C | NM_000321.2 | |
RB1 | Chr13:49047470 | c.2490-26A>C/G/T | NM_000321.2 | |
RB1 | Chr13:49047470 | c.2490-26A>C | NM_000321.2 | |
RB1 | Chr13:49047470 | c.2490-26A>T | NM_000321.2 | |
RB1 | Chr13:49047470 | c.2490-26A>G | NM_000321.2 | |
REST | Chr4:57793760 | c.983-2247C>G | NM_005612.4 | |
RET | Chr10:43572670 | c.-37G>C | NM_020975.4 | rs751005619 |
RET | Chr10:43572680 | c.-27C>G | NM_020975.4 | |
RET | Chr10:43582162 | c.73+9385_73+9395delAGCAACTGCCA | NM_020975.4 | rs368137511 |
RET | Chr10:43606948 | c.1522+35C>T | NM_020975.4 | rs377130948 |
RET | Chr10:43612192 | c.2284+13C>T | NM_020975.4 | |
RET | Chr10:43612198 | c.2284+19C>T | NM_020975.4 | |
RET | Chr10:43613947 | c.2392+19T>C | NM_020975.4 | rs778745375 |
SMARCB1 | Chr22:24130008 | c.93+559A>G | NM_003073.3 | |
SMARCB1 | Chr22:24176316 | c.1119-12C>G | NM_003073.3 | |
SMARCB1 | Chr22:24176437 | c.*70C>T | NM_003073.3 | |
SMARCB1 | Chr22:24176449 | c.*82C>T | NM_003073.3 | |
STK11 | Chr19:1220520 | c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG | NM_000455.4 | |
STK11 | Chr19:1220530 | c.598-32_597+31delGCCCCCTCCCGGGC | NM_000455.4 | |
TERC | Chr3:169482870 | n.-22C>T | NR_001566.1 | |
TERC | Chr3:169482906 | NR_001566.1 | ||
TERC | Chr3:169482948 | n.-100C>G | NR_001566.1 | rs199422256 |
TERC | Chr3:169483086 | NR_001566.1 | rs199422255 | |
TERT | Chr5:1271334 | c.2383-15C>T | NM_198253.2 | rs574645600 |
TERT | Chr5:1295161 | c.-57A>C | NM_198253.2 | |
TMEM127 | Chr2:96931137 | c.-18C>T | NM_017849.3 | rs121908813 |
TP53 | Chr17:7571520 | NM_000546.5 | ||
TP53 | Chr17:7577647 | c.673-39G>A | NM_000546.5 | |
TP53 | Chr17:7579601 | c.97-11C>G | NM_000546.5 | |
TP53 | Chr17:7590694 | c.-29+1G>T | NM_000546.5 | |
TSC1 | Chr9:135800306 | c.363+668G>A | NM_000368.4 | |
TSC2 | Chr16:2098067 | c.-30+1G>C | NM_000548.3 | rs587778004 |
TSC2 | Chr16:2106052 | c.600-145C>T | NM_000548.3 | |
TSC2 | Chr16:2107460 | c.848+281C>T | NM_000548.3 | rs45517132 |
TSC2 | Chr16:2110656 | c.976-15G>A | NM_000548.3 | rs45517150 |
TSC2 | Chr16:2127477 | c.2838-122G>A | NM_000548.3 | |
TSC2 | Chr16:2138031 | c.5069-18A>G | NM_000548.3 | rs45484794 |
VHL | Chr3:10183453 | c.-75_-55delCGCACGCAGCTCCGCCCCGCG | NM_000551.3 | rs727503744 |
VHL | Chr3:10183471 | c.-54_-44dupTCCGACCCGCG | NM_000551.3 | |
VHL | Chr3:10191719 | c.*70C>A | NM_000551.3 | |
VHL | Chr3:10191719 | c.*70C>T | NM_000551.3 | rs552290225 |
WRN | Chr8:30966107 | c.2089-3024A>G | NM_000553.4 | rs281865157 |
WRN | Chr8:30999982 | c.3234-160A>G | NM_000553.4 | |
XPA | Chr9:100449555 | c.390-12A>G | NM_000380.3 | |
XPC | Chr3:14187285 | c.*156G>A | NM_004628.4 | rs121965092 |
XPC | Chr3:14209904 | c.413-24A>G | NM_004628.4 | rs794729657 |
Added and removed genes from the panel
Genes added | Genes removed |
---|---|
GPR101 HAVCR2 KIF1B SMARCE1 CTNNA1 TRIP13 |
Test Strengths
Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.
- CAP accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
- Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
- Our publicly available analytic validation demonstrating complete details of test performance
- ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
This panel may not detect inversions, including the inversion of exons 1-7 of MSH2. The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: PDGFRA (NM_001347828:2), PMS1 (NM_001321049:4), SDHD (NM_001276506:4). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section and see our Analytic Validation.
The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.
Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).
Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.
The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Seattle, WA, are equivalent.
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Sensitivity % (TP/(TP+FN) | Specificity % | |
---|---|---|
Single nucleotide variants | 99.89% (99,153/99,266) | >99.9999% |
Insertions, deletions and indels by sequence analysis | ||
1-10 bps | 99.2% (7,745/7,806) | >99.9999% |
11-50 bps | 99.13% (2,524/2,546) | >99.9999% |
Copy number variants (exon level dels/dups) | ||
1 exon level deletion (heterozygous) | 100% (20/20) | NA |
1 exon level deletion (homozygous) | 100% (5/5) | NA |
1 exon level deletion (het or homo) | 100% (25/25) | NA |
2-7 exon level deletion (het or homo) | 100% (44/44) | NA |
1-9 exon level duplication (het or homo) | 75% (6/8) | NA |
Simulated CNV detection | ||
5 exons level deletion/duplication | 98.7% | 100.00% |
Microdeletion/-duplication sdrs (large CNVs, n=37)) | ||
Size range (0.1-47 Mb) | 100% (25/25) | |
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||
Mean sequencing depth | 143X | |
Nucleotides with >20x sequencing coverage (%) | 99.86% |
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
Sensitivity % | Specificity % | |
---|---|---|
ANALYTIC VALIDATION (NA samples; n=4) | ||
Single nucleotide variants | ||
Heteroplasmic (45-100%) | 100.0% (50/50) | 100.0% |
Heteroplasmic (35-45%) | 100.0% (87/87) | 100.0% |
Heteroplasmic (25-35%) | 100.0% (73/73) | 100.0% |
Heteroplasmic (15-25%) | 100.0% (77/77) | 100.0% |
Heteroplasmic (10-15%) | 100.0% (74/74) | 100.0% |
Heteroplasmic (5-10%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (<5%) | 50.0% (2/4) | 100.0% |
CLINICAL VALIDATION (n=76 samples) | ||
All types | ||
Single nucleotide variants n=2026 SNVs | ||
Heteroplasmic (45-100%) | 100.0% (1940/1940) | 100.0% |
Heteroplasmic (35-45%) | 100.0% (4/4) | 100.0% |
Heteroplasmic (25-35%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (15-25%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (10-15%) | 100.0% (9/9) | 100.0% |
Heteroplasmic (5-10%) | 92.3% (12/13) | 99.98% |
Heteroplasmic (<5%) | 88.9% (48/54) | 99.93% |
Insertions and deletions by sequence analysis n=40 indels | ||
Heteroplasmic (45-100%) 1-10bp | 100.0% (32/32) | 100.0% |
Heteroplasmic (5-45%) 1-10bp | 100.0% (3/3) | 100.0% |
Heteroplasmic (<5%) 1-10bp | 100.0% (5/5) | 99,997% |
SIMULATION DATA /(mitomap mutations) | ||
Insertions, and deletions 1-24 bps by sequence analysis; n=17 | ||
Homoplasmic (100%) 1-24bp | 100.0% (17/17) | 99.98% |
Heteroplasmic (50%) | 100.0% (17/17) | 99.99% |
Heteroplasmic (25%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (20%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (15%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (10%) | 94.1% (16/17) | 100.0% |
Heteroplasmic (5%) | 94.1% (16/17) | 100.0% |
Copy number variants (separate artifical mutations; n=1500) | ||
Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | 100.0% |
Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | 100.0% |
The performance presented above reached by following coverage metrics at assay level (n=66) | ||
Mean of medians | Median of medians | |
Mean sequencing depth MQ0 (clinical) | 18224X | 17366X |
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) | 100% | |
rho zero cell line (=no mtDNA), mean sequencing depth | 12X |
Bioinformatics
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
Clinical interpretation
We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.
The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.
Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.
Other
- American Cancer Society
- American Multiple Endocrine Neoplasia Support
- Beckwith-Wiedemann Children’s Foundation International
- Bonnie J. Addario Lung Cancer Foundation
- Bright Pink
- Canadian Cancer Society
- Cancer.Net - Juvenile Polyposis Syndrome
- Child Neurology Foundation - NF Type 1
- Fighting Hereditary Breast and Ovarian Cancer
- Gastro-Intestinal Cancer Institute
- GeneReviews - BRCA1 and BRCA2 Hereditary Breast and Ovarian Cancer
- GeneReviews - BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer
- GeneReviews - Beckwith-Wiedemann Syndrome
- GeneReviews - Bloom's Syndrome
- GeneReviews - Gorlin Syndrome
- GeneReviews - Hereditary Diffuse Gastric Cancer
- GeneReviews - Hereditary Paraganglioma-Pheochromocytoma Syndromes
- GeneReviews - Li-Fraumeni Syndrome
- GeneReviews - Lynch Syndrome
- GeneReviews - Multiple Endocrine Neoplasia Type 1
- GeneReviews - Multiple Endocrine Neoplasia Type 2
- GeneReviews - Neurofibromatosis 1
- GeneReviews - Neurofibromatosis 2
- GeneReviews - Peutz-Jeghers Syndrome
- GeneReviews - Retinoblastoma
- GeneReviews - Rothmund-Thomson Syndrome
- GeneReviews - Simpson-Golabi-Behmel Syndrome Type 1
- GeneReviews - Tuberous Sclerosis
- GeneReviews - Von Hippel-Lindau Syndrome
- GeneReviews - Werner Syndrome
- HBOC Society
- Li-Fraumeni Syndrome Association
- Lung Cancer Alliance
- Lung Cancer Loundation of America
- Lynch Syndrome International
- NORD - Beckwith-Wiedemann Syndrome
- NORD - Bloom Syndrome
- NORD - Familial Adenomatous Polyposis
- NORD - Gorlin Syndrome
- NORD - Multiple Endocrine Neoplasia Type 1
- NORD - Multiple Endocrine Neoplasia Type 2
- NORD - Neurofibromatosis Type 1 (NF1)
- NORD - Peutz Jeghers Syndrome
- NORD - Pheochromocytoma
- NORD - Retinoblastoma
- NORD - Rothmund-Thomson Syndrome
- NORD - Simpson-Golabi-Behmel Syndrome
- NORD - Tuberous Sclerosis
- NORD - Von Hippel-Lindau Syndrome
- NORD - Werner Syndrome
- Neurofibromatosis Network
- Rothmund-Thomson Syndrome Foundation
- The Bloom Syndrome Foundation
- The Eye Cancer Foundation
- The Neuro Foundation - NF Type 2
- Tuberous Sclerosis Complex International
- VHL Alliance