Comprehensive Hereditary Cancer Panel

Last modified: Jun 12, 2018

Summary

  • Is a 146 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of inherited susceptibility to cancer. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.

Analysis methods

  • PLUS
  • SEQ
  • DEL/DUP

Availability

4 weeks

Number of genes

146

Test code

ON1001

Panel size

Large

CPT codes

SEQ 81432
DEL/DUP 81433

Summary

The Blueprint Genetics Comprehensive Hereditary Cancer Panel (test code ON1001):

  • Is a 146 gene panel that includes assessment of selected non-coding disease-causing variants
  • Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

  • Is available as PLUS analysis (sequencing analysis and deletion/duplication analysis), sequencing analysis only or deletion/duplication analysis only

Test Specific Strength

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

Sample Requirements

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 3μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Hereditary cancer syndromes account for approximately 5-10% of all cancer. These cancers originate from the gastrointestinal tract, endocrine and neuroendocrine systems or from different organs like lung, kidneys, liver, pancreas, skin, and eyes. Hereditary cancer is suspected when there are multiple relatives on the same side of the family with the same or related forms of cancer, cancer at an early age or multiple primary cancers in an individual. The most common inherited cancer syndromes are hereditary breast and ovarian cancer syndrome, Lynch syndrome (also known as hereditary non-polyposis colorectal cancer), Li-Fraumeni syndrome, PTEN hamartoma tumor syndrome, familial adenomatous polyposis, Von-Hippel Lindau syndrome, and multiple endocrine neoplasia type 1 and type 2. Most of the hereditary cancer syndromes are inherited in an autosomal dominant manner and penetrance is high. Genetic testing is the most effective way to identify individuals with a genetic predisposition to develop cancer. Accurate genetic diagnosis enables personal cancer risk assessment and inherited genetic variant can be taken into account when planning the treatment and the follow-up of both unaffected and affected persons. In most of the cases, cancer mortality can be significantly reduced in high-risk individuals by regular surveillance and preventive strategies.

Genes in the Comprehensive Hereditary Cancer Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
AIP Pituitary adenoma, familial isolated AD 53 106
ALK Neuroblastoma AD 29 15
ANKRD26 Thrombocytopenia AD 6 21
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 672 1907
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 860 1026
AXIN2 Oligodontia-colorectal cancer syndrome, Oligondontia, isolated AD 10 18
BAP1 Tumor predisposition syndrome AD 52 106
BARD1 Breast cancer AD 130 105
BLM Bloom syndrome AR 91 107
BMPR1A* Polyposis, juvenile intestinal AD 87 135
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 135 65
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2560 2361
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 2959 2364
BRIP1 Fanconi anemia, Breast cancer AD/AR 182 166
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 12 27
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 23 38
CD70 Primary immunodeficiency AR 3
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 42 90
CDH1 CDH1-related cancer, Blepharocheilodontic syndrome 1 AD 152 219
CDK4 Melanoma, cutaneous malignant AD 4 13
CDKN1B Multiple endocrine neoplasia AD 12 18
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 28 81
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 81 230
CEBPA Acute myeloid leukemia, familial AD 15 10
CEP57 Mosaic variegated aneuploidy syndrome AR 5 4
CHEK2* Li-Fraumeni syndrome AD/AR 213 174
CYLD Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis AD 34 106
DDB2 Xeroderma pigmentosum AR 4 15
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple types, susceptibility to AD 8 14
DICER1* DICER1 syndrome AD 177 126
DIS3L2* Perlman syndrome AR 10 11
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 47 71
EGFR Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial AD/AR 54 14
ELANE Neutropenia AD 38 215
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 26 75
ERCC1 Cerebrooculofacioskeletal syndrome 4 AR 8 4
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive, Cerebrooculofacioskeletal syndrome 2 AR 24 93
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 10 18
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 11 59
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 21 52
ETV6 Thrombocytopenia 5 AD 10 33
EXO1 Lynch syndrome AD/AR 14
EXT1 Multiple cartilagenious exostoses 1 AD 67 497
EXT2 Multiple cartilagenious exostoses 2 AD 32 242
EZH2 Weaver syndrome AD 29 40
FANCA Fanconi anemia AR 76 541
FANCB Fanconi anemia XL 10 20
FANCC Fanconi anemia AR 70 58
FANCD2* Fanconi anemia AR 14 57
FANCE Fanconi anemia AR 5 16
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 13 89
FANCI Fanconi anemia AR 12 43
FANCL Fanconi anemia AR 7 22
FANCM Fanconi anemia AR 2 49
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 156 205
FLCN Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous AD 139 190
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 26 105
GPC3 Simpson-Golabi-Behmel syndrome XL 29 72
GREM1 Hereditary mixed polyposis syndrome AD/AR 1 6
HNF1A Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis AD 72 524
HOXB13 Familial prostate cancer AD/AR 1 5
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 41 29
IKZF1# Immunodeficiency, common variable, 13 AD 7 12
KIT Gastrointestinal stromal tumor, Piebaldism AD 75 110
KITLG Hyperpigmentation with or without hypopigementation, familial progressive, Skin/hair/eye pigmentation, variation in, 7 AD 6 10
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 61 34
LZTR1 Schwannomatosis, Noonan syndrome AD 27 64
MAP2K1 Cardiofaciocutaneous syndrome AD 45 21
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MAX Pheochromocytoma AD 11 25
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 239 726
MET Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to AD/AR 20 29
MITF Tietz albinism-deafness syndrome, Waardenburg syndrome AD/AR 28 55
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 829 1174
MLH3 Colorectal cancer, hereditary nonpolyposis, Endometrial carcinoma AD 6 31
MRE11A Ataxia-telangiectasia-like disorder-1 AR 57 51
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 874 1224
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 580 569
MUTYH Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas AR 118 159
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 141 87
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 810 2703
NF2 Schwannomatosis, Neurofibromatosis AD 47 428
NRAS Noonan syndrome AD 31 14
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 303 515
NSUN2 Dubowitz syndrome, Non-syndromic intellectual disability AD/AR 8 7
NTHL1 Familial adenomatous polyposis 3 AR 4 3
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 422 358
PAX5 Pre-B cell acute lymphoblastic leukemia AD 5
PDGFRA Gastrointestinal stromal tumor AD 22 17
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 10 80
PMS1 Hereditary nonpolyposis colon cancer AD/AR 1 25
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 259 324
POLD1 Colorectal cancer, Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome AD 3 29
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 7 50
POLH* Xeroderma pigmentosum, variant type AR 20 76
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 33
PPM1D Hereditary breast cancer AD 14 59
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 22 172
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 66 180
PTCH1 Basal cell nevus syndrome AD 147 411
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 398 627
PTPN11 Noonan syndrome, Metachondromatosis AD 128 139
RAD50 Breast cancer, Nijmegen breakage syndrome-like disorder AD 148 82
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 92 112
RAD51D# Ovarian cancer, familial AD 64 70
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 44 48
RASA2# Noonan syndrome AD 1 3
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 53 100
REST Fibromatosis, gingival, 5 AD 3 15
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 84 402
RHBDF2 Tylosis with esophageal cancer AD 2 3
RIT1 Noonan syndrome AD 20 25
RRAS Noonan-syndrome like phenotype AD/AR 2
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 25 92
SAMD9L Ataxia-pancytopenia syndrome AD 4 4
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AD/AR 21 90
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 42 58
SDHAF2 Paragangliomas AD 3 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 138 262
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 26 57
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 62 164
SHOC2 Noonan-like syndrome with loose anagen hair AD 2 4
SLX4 Fanconi anemia AR 14 54
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 162 141
SMARCA4 Rhabdoid tumor predisposition syndrome AD 55 55
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome AD 31 116
SOS1 Noonan syndrome AD 45 67
SOS2 Noonan syndrome 9 AD 3 6
SPRED1 Legius syndrome AD 23 71
SRP72* Bone marrow failure syndrome 1 AD 2 2
STK11 Peutz-Jeghers syndrome AD 149 436
SUFU Medulloblastoma, Basal cell nevus syndrome AD 15 38
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 38 67
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 43 152
TINF2 Revesz syndrome, Dyskeratosis congenita AD 23 37
TMEM127 Pheochromocytoma AD 25 41
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 372 481
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 138 346
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 322 1137
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 188 595
WRN* Werner syndrome AR 36 103
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 AD 36 175
XPA Xeroderma pigmentosum AR 14 45
XPC Xeroderma pigmentosum AR 22 90
XRCC2 Hereditary breast cancer AD/AR 10 20

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by the panel

Gene Genomic location HG19 HGVS RefSeq RS-number
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
AIP Chr11:67250359 c.-270_269delinsAA NM_003977.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043009–112043595
APC Chr5:112072710–112073585
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108121024 c.1236-404C>T NM_000051.3
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41196977 c.*718A>G NM_007294.3
BRCA1 Chr17:41196895 c.*800T>C NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
BUB1B Chr15:40409289 c.-44133G>A NM_001211.5 rs576524605
BUB1B Chr15:40504689 c.2386-11A>G NM_001211.5 rs751421137
CDH1 Chr16:68842843 c.687+92T>A NM_004360.3
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs774454456
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs869312166
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs774454456,rs869312166
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN1B Chr12:12870694 c.-80C>T NM_004064.3 rs551236750
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CDKN2A Chr9:21974860 c.-34G>T NM_000077.4 rs1800586
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21972311 c.151-1104C>G NM_000077.4
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CYLD Chr16:50813428 c.1139-148A>G NM_015247.2
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
ERCC1 Chr19:45918244 c.603-26G>A NM_202001.2 rs367887072
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89864654 c.893+920C>A NM_000135.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
HNF1A Chr12:121416453 c.-119G>A NM_000545.5 rs371945966
HNF1A Chr12:121416448 c.-124G>C NM_000545.5 rs563304627
HNF1A Chr12:121416385 c.-187C>A/T NM_000545.5
HNF1A Chr12:121416354 c.-218T>C NM_000545.5
HNF1A Chr12:121416314 c.-258A>G NM_000545.5 rs756136537
HNF1A Chr12:121416289 c.-283A>C NM_000545.5
HNF1A Chr12:121416285 c.-287G>A NM_000545.5
HNF1A Chr12:121416281 c.-291T>C NM_000545.5 rs534474388
HNF1A Chr12:121416110 c.-462G>A NM_000545.5
HNF1A Chr12:121416034 c.-538G>C NM_000545.5
HNF1A Chr12:121416510 c.-62C>G NM_000545.5 rs753567412
HNF1A Chr12:121416475 c.-97T>G NM_000545.5
LZTR1 Chr22:21340117 c.264-13G>A NM_006767.3 rs587777176
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37053487 c.589-9_589-6delGTTT NM_000249.3 rs752286654,rs587779026
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47635062 c.212-478T>G NM_000251.2 rs587779138
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MUTYH Chr1:45797534 c.998-13T>G NM_001128425.1
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NSUN2 Chr5:6622224 c.538-11T>G NM_017755.5
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PDGFRA Chr4:55161473 c.*34G>A NM_006206.4 rs552950826
POLH Chr6:43544178 c.-5+1G>C NM_006502.2
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89622883–89623482
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERT Chr5:1295161 c.-57A>C NM_198253.2
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4
XPA Chr9:100449555 c.390-12A>G NM_000380.3
XPC Chr3:14187285 c.*156G>A NM_004628.4 rs121965092
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

Test strength

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

The strengths of this test include:
  • CAP and ISO-15189 accreditations covering all operations at Blueprint Genetics including all Whole Exome Sequencing, NGS panels and confirmatory testing
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publically available analytic validation demonstrating complete details of test performance
  • ~1,500 non-coding disease causing variants in Blueprint WES assay (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification based on modified ACMG variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test limitations

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics comprehensive hereditary cancer panel covers classical genes associated with Bloom syndrome, hereditary cancer, Beckwith-Wiedemann syndrome, Gorlin syndrome, Hereditary breast and ovarian cancer syndrome, Li-Fraumeni syndrome, Peutz-Jeghers syndrome, Rothmund-Thomson syndrome, Simpson-Golabi-Behmel syndrome, Werner syndrome, Von Hippel-Lindau disease, hereditary nonpolyposis colon cancer, Juvenile polyposis syndrome, medulloblastoma predisposition, multiple endocrine neoplasia, nephroblastoma, Pleuropulmonary blastoma family tumor susceptibility syndrome, tuberous sclerosis complex, familial adenomatous polyposis, hereditary pheochromocytoma-paraganglioma, neurofibromatosis type 1 and neurofibromatosis type 2. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics Whole Exome Sequencing (WES) assay. All individual panels are sliced from WES data.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.65% (412,456/413,893) >99.99%
Insertions, deletions and indels by sequence analysis
1-10 bps 96.94% (17,070/17,608) >99.99%
11-50 bps 99.07% (957/966) >99.99%
Copy number variants (exon level dels/dups)
Clinical samples (small CNVs, n=52)
1 exon level deletion 92.3% (24/26) NA
2 exons level deletion/duplication 100.0% (11/11) NA
3-7 exons level deletion/duplication 93.3% (14/15) NA
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
Simulated CNV detection
2 exons level deletion/duplication 90.98% (7,357/8,086) 99.96%
5 exons level deletion/duplication 98.63% (7,975/8,086) 99.98%
     
The performance presented above reached by WES with the following coverage metrics
     
Mean sequencing depth at exome level 174x
Nucleotides with >20x sequencing coverage (%) 99.4%

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling all of the following criteria are not Sanger confirmed: 1) the variant quality score is above the internal threshold for a true positive call, 2) an unambiguous IGV in-line with the variant call and 3) previous Sanger confirmation of the same variant at least three times at Blueprint Genetics. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation databases to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

General resources