Comprehensive Hereditary Cancer Panel

  • bpg-method PLUS
  • bpg-method SEQ
  • bpg-method DEL/DUP

Test code: ON1001

The Blueprint Genetics Comprehensive Hereditary Cancer Panel analyzes 117 genes associated with inherited suscebtibility to cancer.

This Panel covers genes associated with a broad spectrum of hereditary cancer syndromes, conferring susceptibility to hematological and/or solid tumors. The Comprehensive Hereditary Cancer Panel is suited for detecting heritable germline mutations and may not be used for the detection of somatic mutations in tumor tissue. This Panel covers all genes included in individual Blueprint Genetics Hereditary Cancer subpanels.

About Hereditary Cancers

Hereditary cancer syndromes account for approximately 5-10% of all cancer. These cancers originate from gastrointestinal tract, endocrine and neuroendocrine systems or from different organs like lung, kidneys, liver, pancreas, skin, and eyes. Hereditary cancer is suspected when there are multiple relatives on the same side of the family with the same or related forms of cancer, cancer at an early age or multiple cancers in an individual. The most common inherited cancer syndromes are hereditary breast and ovarian cancer syndrome, Lynch syndrome (also known as hereditary non-polyposis colorectal cancer), Li-Fraumeni syndrome, Cowden syndrome, familial adenomatous polyposis, Von-Hippel Lindau syndrome, and multiple endocrine neoplasia type 1 and type 2. Most of the hereditary cancer syndromes are inherited in an autosomal dominant manner and penetrance is high. Genetic testing is the most effective way to identify individuals with genetic predisposition of developing cancer. Accurate genetic diagnosis enables personal cancer risk assessment and inherited genetic defect can be taken into account when planning the treatment or moreover the follow-up of both unaffected and affected persons. In most of the cases, cancer mortality can be significantly reduced in high-risk individuals by regular surveillance and preventive strategies.

Availability

Results in 3-4 weeks. We do not offer a maternal cell contamination (MCC) test at the moment. We offer prenatal testing only for cases where the maternal cell contamination studies (MCC) are done by a local genetic laboratory. Read more: http://blueprintgenetics.com/faqs/#prenatal

Genes in the Comprehensive Hereditary Cancer Panel and their clinical significance
Gene Associated phenotypes Inheritance ClinVar HGMD
AIP Pituitary adenoma, familial isolated AD 54 106
ALK Neuroblastoma AD 28 13
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 546 1856
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 646 923
AXIN2 Oligodontia-colorectal cancer syndrome AD 6 14
BAP1 Tumor predisposition syndrome AD 33 94
BARD1 Breast cancer AD 71 74
BLM Bloom syndrome AR 83 91
BMPR1A* Polyposis, juvenile intestinal AD 65 119
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2448 2175
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 2771 2045
BRIP1 Fanconi anemia, Breast cancer AD/AR 122 130
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 13 25
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 36 87
CDH1 CDH1-related cancer AD 103 182
CDK4 Melanoma, cutaneous malignant AD 4 11
CDKN1B Multiple endocrine neoplasia AD 10 18
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 24 81
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 69 218
CEBPA Acute myeloid leukemia, familial AD 15 10
CEP57 Mosaic variegated aneuploidy syndrome AR 5 4
CHEK2* Li-Fraumeni syndrome AD/AR 131 129
CYLD Spiegler-Brooke syndrome, Trichoepithelioma, multiple, Cylindromatosis AD 34 105
DDB2 Xeroderma pigmentosum AR 4 15
DICER1* DICER1 syndrome AD 160 123
DIS3L2* Perlman syndrome AR 9 11
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 47 71
EGFR Lung cancer, familial, susceptibilty to, Inflammatory skin and bowel disease, neonatal, Acute myeloid leukemia, familial AD/AR 53 13
ELANE Neutropenia AD 37 213
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 20 69
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 22 86
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 10 17
ERCC4 Fanconi anemia, Xeroderma pigmentosum AR 11 43
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 18 51
EXO1 Lynch syndrome AD/AR 13
EXT1 Multiple cartilagenious exostoses 1 AD 44 481
EXT2 Multiple cartilagenious exostoses 2 AD 24 229
EZH2 Weaver syndrome AD 26 37
FANCA Fanconi anemia AR 59 520
FANCB Fanconi anemia XL 10 18
FANCC Fanconi anemia AR 63 45
FANCD2* Fanconi anemia AR 13 56
FANCE Fanconi anemia AR 5 16
FANCF Fanconia anemia AR 7 15
FANCG Fanconi anemia AR 13 84
FANCI Fanconi anemia AR 13 40
FANCL Fanconi anemia AR 7 20
FANCM Fanconi anemia AR 1 43
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 142 174
FLCN Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous AD 127 183
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 22 105
GPC3 Simpson-Golabi-Behmel syndrome XL 26 72
GREM1 Hereditary mixed polyposis syndrome AD/AR 6
HNF1A Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis AD 61 511
HOXB13 Familial prostate cancer AD/AR 5
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 39 27
KIT Gastrointestinal stromal tumor AD 73 109
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 59 31
MAX Pheochromocytoma AD 8 23
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 219 714
MET Deafness, Renal cell carcinoma, papillary AD/AR 20 24
MITF Renal cell carcinoma with or without malignant melanoma, Tietz albinism-deafness syndrome, Waardenburg syndrome, Melanoma, cutaneous malignant AD 24 55
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 748 1119
MLH3 Colorectal cancer, hereditary nonpolyposis, Endometrial carcinoma AD 5 26
MRE11A Ataxia-telangiectasia-like disorder-1 AR 35 43
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 803 1147
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 480 472
MUTYH Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas AR 97 144
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 95 65
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 592 2681
NF2 Schwannomatosis, Neurofibromatosis AD 31 428
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 268 509
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 317 274
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 6 78
PMS1 Hereditary nonpolyposis colon cancer AD/AR 1 9
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 196 284
POLD1 Colorectal cancer AD 3 21
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 29
PPM1D Hereditary breast cancer AD 7 59
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 17 169
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 63 174
PTCH1 Basal cell nevus syndrome AD 122 397
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 329 599
PTPN11 LEOPARD syndrome, Noonan syndrome, Metachondromatosis AD 124 135
RAD50 Breast cancer AD 90 58
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 60 95
RAD51D Ovarian cancer, familial AD 40 57
RB1 Retinoblastoma AD 207 1077
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 43 96
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 82 393
RHBDF2 Tylosis with esophageal cancer AD 2 3
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 24 82
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AD/AR 18 88
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM) AD/AR 29 51
SDHAF2 Paragangliomas AD 3 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 123 259
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 23 56
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome AD 56 160
SLX4 Fanconi anemia AR 11 49
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 139 132
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome AD 22 115
STK11 Peutz-Jeghers syndrome AD 135 412
SUFU Medulloblastoma, Basal cell nevus syndrome AD 12 25
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD 37 67
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, telomere-related, Dyskeratosis congenita AD/AR 44 149
TINF2 Revesz syndrome, Dyskeratosis congenita AD 23 34
TMEM127 Pheochromocytoma AD 20 40
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 340 405
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 106 336
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 260 1093
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 170 594
WRN* Werner syndrome AR 25 102
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor AD 29 172
XPA Xeroderma pigmentosum AR 14 44
XPC Xeroderma pigmentosum AR 19 86
XRCC2 Hereditary breast cancer AD/AR 8 15

*Some regions of the gene are duplicated in the genome leading to limited sensitivity within the regions. Thus, low-quality variants are filtered out from the duplicated regions and only high-quality variants confirmed by other methods are reported out. Read more.

Gene, refers to HGNC approved gene symbol; Inheritance to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR) and X-linked (XL); ClinVar, refers to a number of variants in the gene classified as pathogenic or likely pathogenic in ClinVar (http://www.ncbi.nlm.nih.gov/clinvar/); HGMD, refers to a number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD, http://www.hgmd.cf.ac.uk/ac/). The list of associated (gene specific) phenotypes are generated from CDG (http://research.nhgri.nih.gov/CGD/) or Orphanet (http://www.orpha.net/) databases.

Gene Genomic location HG19 HGVS RefSeq RS-number
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
AIP Chr11:67250359 c.-270_269delinsAA NM_003977.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043220 c.-195A>C NM_001127511.2
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs774454456
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs869312166
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN1B Chr12:12870694 c.-80C>T NM_004064.3 rs551236750
CDKN2A Chr9:21974860 c.-34G>T NM_000077.4 rs1800586
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47635062 c.212-478T>G NM_000251.2 rs587779138
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
RB1 Chr13:48877860 c.-189G>T NM_000321.2 rs387906520
RB1 Chr13:48877851 c.-198G>A NM_000321.2 rs387906521
RB1 Chr13:49046098 c.2490-1398A>G NM_000321.2
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

The strengths of this test include:

  • Blueprint Genetics is one of the few laboratories worldwide with CAP and ISO-15189 accreditation for NGS panels and CLIA certification
  • Superior sequencing quality
  • Careful selection of genes based on current literature, our experience and the most current mutation databases
  • Transparent and easy access to quality and performance data at the patient level that are accessible via our Nucleus portal
  • Transparent and reproducible analytical validation for each panel (see Test performance section; for complete details, see our Analytic Validation)
  • Sequencing and high resolution del/dup analysis available in one test
  • Inclusion of non-coding disease causing variants where clinically indicated (please see individual Panel descriptions)
  • Interpretation of variants following ACMG variant classification guidelines
  • Comprehensive clinical statement co-written by a PhD geneticist and a clinician specialist

 

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Variants in regulatory or non-coding regions of the gene unless otherwise indicated (please see Non-coding disease causing variants covered by the panel). This mean for instance intronic variants locating deeper than 15 nucleotides from the exon-intron boundary.

 

This test may not reliably detect the following:

  • Low level mosaicism
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Disorders caused by long repetitive sequences (e.g. trinucleotide repeat expansions)

 

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

Blueprint Genetics offers a Comprehensive Hereditary Cancer Panel that covers classical genes associated with Beckwith-Wiedemann syndrome, Bloom syndrome, familial adenomatous polyposis, Gorlin syndrome, hereditary breast and ovarian cancer syndrome, hereditary cancer, hereditary nonpolyposis colon cancer, hereditary pheochromocytoma-paraganglioma, hereditary retinoblastoma, juvenile polyposis syndrome, Li-Fraumeni syndrome, medulloblastoma predisposition, multiple endocrine neoplasia, nephroblastoma, neurofibromatosis type 1, neurofibromatosis type 2, Peutz-Jeghers syndrome, pleuropulmonary blastoma family tumor susceptibility syndrome, Rothmund-Thomson syndrome, Simpson-Golabi-Behmel syndrome, tuberous sclerosis complex, Von Hippel-Lindau disease and Werner syndrome. The genes are carefully selected based on the existing scientific evidence, our experience and most current mutation databases. Candidate genes are excluded from this first-line diagnostic test. The test does not recognise balanced translocations or complex inversions, and it may not detect low-level mosaicism. The test should not be used for analysis of sequence repeats or for diagnosis of disorders caused by mutations in the mitochondrial DNA.

Analytical validation is a continuous process at Blueprint Genetics. Our mission is to improve the quality of the sequencing process and each modification is followed by our standardized validation process. Average sensitivity and specificity in Blueprint NGS Panels is 99.3% and 99.9% for detecting SNPs. Sensitivity to for indels vary depending on the size of the alteration: 1-10bps (96.0%), 11-20 bps (88.4%) and 21-30 bps (66.7%). The longest detected indel was 46 bps by sequence analysis. Detection limit for Del/Dup (CNV) analysis varies through the genome depending on exon size, sequencing coverage and sequence content. The sensitivity is 71.5% for single exon deletions and duplications and 99% for three exons’ deletions and duplications. We have validated the assays for different starting materials including EDTA-blood, isolated DNA (no FFPE) and saliva that all provide high-quality results. The diagnostic yield varies substantially depending on the used assay, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be cost-effective first line test if your patient’s phenotype is suggestive for a specific mutation profile.

The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. The highest relevance in the reported variants is achieved through elimination of false positive findings based on variability data for thousands of publicly available human reference sequences and validation against our in-house curated mutation database as well as the most current and relevant human mutation databases. Reference databases currently used are the 1000 Genomes Project (http://www.1000genomes.org), the NHLBI GO Exome Sequencing Project (ESP; http://evs.gs.washington.edu/EVS), the Exome Aggregation Consortium (ExAC; http://exac.broadinstitute.org), ClinVar database of genotype-phenotype associations (http://www.ncbi.nlm.nih.gov/clinvar) and the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk). The consequence of variants in coding and splice regions are estimated using the following in silico variant prediction tools: SIFT (http://sift.jcvi.org), Polyphen (http://genetics.bwh.harvard.edu/pph2/), and Mutation Taster (http://www.mutationtaster.org).

Through our online ordering and statement reporting system, Nucleus, the customer can access specific details of the analysis of the patient. This includes coverage and quality specifications and other relevant information on the analysis. This represents our mission to build fully transparent diagnostics where the customer gains easy access to crucial details of the analysis process.

In addition to our cutting-edge patented sequencing technology and proprietary bioinformatics pipeline, we also provide the customers with the best-informed clinical report on the market. Clinical interpretation requires fundamental clinical and genetic understanding. At Blueprint Genetics our geneticists and clinicians, who together evaluate the results from the sequence analysis pipeline in the context of phenotype information provided in the requisition form, prepare the clinical statement. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals, even without training in genetics.

Variants reported in the statement are always classified using the Blueprint Genetics Variant Classification Scheme modified from the ACMG guidelines (Richards et al. 2015), which has been developed by evaluating existing literature, databases and with thousands of clinical cases analyzed in our laboratory. Variant classification forms the corner stone of clinical interpretation and following patient management decisions. Our statement also includes allele frequencies in reference populations and in silico predictions. We also provide PubMed IDs to the articles or submission numbers to public databases that have been used in the interpretation of the detected variants. In our conclusion, we summarize all the existing information and provide our rationale for the classification of the variant.

A final component of the analysis is the Sanger confirmation of the variants classified as likely pathogenic or pathogenic. This does not only bring confidence to the results obtained by our NGS solution but establishes the mutation specific test for family members. Sanger sequencing is also used occasionally with other variants reported in the statement. In the case of variant of uncertain significance (VUS) we do not recommend risk stratification based on the genetic finding. Furthermore, in the case VUS we do not recommend use of genetic information in patient management or genetic counseling. For some cases Blueprint Genetics offers a special free of charge service to investigate the role of identified VUS.

We constantly follow genetic literature adapting new relevant information and findings to our diagnostics. Relevant novel discoveries can be rapidly translated and adopted into our diagnostics without delay. These processes ensure that our diagnostic panels and clinical statements remain the most up-to-date on the market.

Find more info in Support

Choose an analysis method

$ $ 1700
$ $ 1000
$ $ 1900
Total $
Order now

ICD & CPT codes

CPT codes

SEQ 81479
DEL/DUP 81479

Accepted sample types

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 5μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Resources

Subscribe to our newsletter