Hereditary Endocrine Cancer Panel

Last modified: Mar 01, 2019


  • Is a 22 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of an inherited susceptibility to endocrine cancer. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue. The genes in this panel are included in the Comprehensive Hereditary Cancer Panel.

Analysis methods

  • PLUS
  • SEQ


4 weeks

Number of genes


Test code


Panel size


CPT codes

SEQ 81437
DEL/DUP 81438


The Blueprint Genetics Hereditary Endocrine Cancer Panel (test code ON0701):

Test Specific Strength

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

ICD codes

Commonly used ICD-10 code(s) when ordering the Hereditary Endocrine Cancer Panel

ICD-10 Disease
Q43.1 Hirschsprung disease (HSCR)
E34.8 Werner syndrome
Q87.89 Birt-Hogg-Dube syndrome
Q85.8 Cowden syndrome
D48.9 Li-Fraumeni syndrome 1
D44.0 Carney complex
D44.9 Carney-Stratakis syndrome
D35.2 Familial isolated pituitary adenoma
C75.0 Hereditary paraganglioma-pheochromocytoma syndromes
E21.0 Hyperparathyroidism-jaw tumor syndrome
E24.8 Primary pigmented nodular adrenocortical disease
Q85.8 Von Hippel-Lindau disease
D44.9 Multiple endocrine neoplasia
D12.6 Familial adenomatous polyposis
E21.0 Familial isolated hyperparathyroidism
C73 Familial medullary thyroid carcinoma
E04.2 Familial multinodular goiter
E21.0 Familial parathyroid adenoma
Q85.00 Neurofibromatosis type 1

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Oragene DNA OG-500 kit/OGD-500 or OG-575 & OGD-575)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. Read more about our sample requirements here.

Hereditary endocrine tumor syndromes result in overproduction of hormones, cause growth of tumors in endocrine glands and increase the lifetime risk of developing metastatic diseases, such as gastrointestinal and pancreatic carcinomas. Genetic conditions that cause tumors of the endocrine glands include rare inherited syndromes such as multiple endocrine neoplasias (MEN1, RET, CDKN1B), familial medullary thyroid carcinoma (RET), familial isolated pituitary adenoma (AIP), Carney complex (PRKAR1A), Hirschsprung disease (RET), and Von Hippel-Lindau disease (VHL). Genetic conditions that cause increased thyroid cancer risk include syndromes such as familial adenomatous polyposis (APC), Li-Fraumeni syndrome (TP53), multiple endocrine neoplasia type 2 and familial medullary thyroid carcinoma (RET), Cowden syndrome (PTEN), Carney complex (PRKAR1A) and DICER1 syndrome (DICER1). Syndromes associated specifically with hereditary paraganglioma-pheochromocytoma are described in the subpanel for these conditions. The prevalences of hereditary endocrine tumor syndromes varies from very rare to 7:100,000 depending on the syndrome in question.

Genes in the Hereditary Endocrine Cancer Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
AIP Pituitary adenoma, familial isolated AD 53 110
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 773 1926
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 50 101
CDKN1B Multiple endocrine neoplasia AD 13 20
DICER1* DICER1 syndrome AD 197 137
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 178 207
MAX Pheochromocytoma AD 13 31
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 263 730
MET Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to AD/AR 20 34
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 122 407
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 54 87
SDHAF2 Paragangliomas AD 4 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 151 272
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 29 60
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 68 170
TMEM127 Pheochromocytoma AD 30 52
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 206 614
WRN* Werner syndrome AR 64 107

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by Hereditary Endocrine Cancer Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
AIP Chr11:67250359 c.-270_269delinsAA NM_003977.2
AIP Chr11:67250410 c.-220G>A NM_003977.2 rs267606540
APC Chr5:112043009–112043595
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112072710–112073585
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
CDKN1B Chr12:12870317 c.-454_-451delTTCC NM_004064.3 rs786201010
CDKN1B Chr12:12870694 c.-80C>T NM_004064.3 rs551236750
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs774454456
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs869312166
CDKN1B Chr12:12870741 c.-29_-26delAGAG NM_004064.3 rs774454456,rs869312166
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTEN Chr10:89622883–89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4

Test strength

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

The strengths of this test include:
  • CAP and ISO-15189 accreditations covering all operations at Blueprint Genetics including all Whole Exome Sequencing, NGS panels and confirmatory testing
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publically available analytic validation demonstrating complete details of test performance
  • ~1,500 non-coding disease causing variants in Blueprint WES assay (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification based on modified ACMG variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test limitations

Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics hereditary endocrine cancer panel covers classical genes associated with Hirschsprung disease (HSCR), Werner syndrome, Birt-Hogg-Dube syndrome, Cowden syndrome, DICER1 syndrome, Li-Fraumeni syndrome 1, endocrine cancer, carney complex, Carney-Stratakis syndrome, familial isolated pituitary adenoma, Hereditary paraganglioma-pheochromocytoma syndromes, Hyperparathyroidism-jaw tumor syndrome, primary pigmented nodular adrenocortical disease, Von Hippel-Lindau disease, multiple endocrine neoplasia, familial adenomatous polyposis, familial isolated hyperparathyroidism, familial medullary thyroid carcinoma, familial multinodular goiter, familial parathyroid adenoma and neurofibromatosis type 1. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics Whole Exome Sequencing (WES) assay. All individual panels are sliced from WES data.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.65% (412,456/413,893) >99.99%
Insertions, deletions and indels by sequence analysis
1-10 bps 96.94% (17,070/17,608) >99.99%
11-50 bps 99.07% (957/966) >99.99%
Copy number variants (exon level dels/dups)
Clinical samples (small CNVs, n=52)
1 exon level deletion 92.3% (24/26) NA
2 exons level deletion/duplication 100.0% (11/11) NA
3-7 exons level deletion/duplication 93.3% (14/15) NA
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
Simulated CNV detection
2 exons level deletion/duplication 90.98% (7,357/8,086) 99.96%
5 exons level deletion/duplication 98.63% (7,975/8,086) 99.98%
The performance presented above reached by WES with the following coverage metrics
Mean sequencing depth at exome level 174x
Nucleotides with >20x sequencing coverage (%) 99.4%


The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling the following criteria are not Sanger confirmed: the variant quality score is above the internal threshold for a true positive call, and visual check-up of the variant at IGV is in-line with the variant call. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation databases to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Birt-Hogg-Dube Syndrome Resources

Cowden Syndrome Resources

Pituitary-Related Resources

Parathyroid-Related Resources

Paraganglioma Resources

Familial Adenomatous Polyposis Resources

Multiple Endocrine Neoplasia Resources

von Hippel-Lindau Syndrome Resources

Thyroid-Related Resources
