Hereditary Gastrointestinal Cancer Panel

  • bpg-method PLUS
  • bpg-method SEQ
  • bpg-method DEL/DUP

Test code: ON1601

The Blueprint Genetics Hereditary Gastrointestinal Cancer Panel analyzes 38 genes associated with inherited susceptibility to gastrointestinal cancer.

The panel covers genes associated with hereditary colorectal cancer syndromes, familial pancreatic cancer, hereditary diffuse gastric cancer and gastrointestinal stromal tumors. Also other syndromes associated with increased risk of gastrointestinal cancer are covered. The Hereditary Gastrointestinal Cancer Panel is suited for detecting heritable germline mutations and may not be used for the detection of somatic mutations in tumor tissue. This comprehensive Panel includes Hereditary Colorectal Cancer and Hereditary Pancreatic Cancer Panels. All genes in this Panel are included in the Comprehensive Hereditary Cancer Panel.

About Hereditary Gastrointestinal Cancer

Gastrointestinal cancers refers to malignant tumors arising from the gastrointestinal tract and accessory organs of digestion including the esophagus, stomach, pancreas, small intestine, large intestine, and rectum. Hereditary diffuse gastric cancer is caused by germline mutations in CDH1. The average age of onset is 38 years and the estimated cumulative risk of gastric cancer by age of 80 years is 80% for both men and women. Women also have a 39%-52% risk for lobular breast cancer. Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the human gastrointestinal tract. Germline mutations in KIT have been implicated in inherited susceptibility to GISTs (PMID: 16143141). Familial GIST is characterized by autosomal dominant inheritance and high penetrance. GIST rarely occurs in association with other syndromes such as neurofibromatosis type 1 , caused by germline mutations in NF1. Carney-Stratakis syndrome is characterized by paraganglioma and gastric stromal sarcoma and is caused by germline mutations in SDHB, SDHC, and SDHD (PMID: 17667967). Germline mutations in RHBDF2 have been associated with tylosis esophageal cancer that is an autosomal dominant syndrome characterized by palmoplantar keratoderma, oral precursor lesions, and a high lifetime risk of esophageal cancer (PMID: 22265016). Hereditary colorectal cancer syndromes and familial pancreatic cancer are described in the subpanels for these conditions.

Availability

Results in 3-4 weeks. We do not offer a maternal cell contamination (MCC) test at the moment. We offer prenatal testing only for cases where the maternal cell contamination studies (MCC) are done by a local genetic laboratory. Read more: http://blueprintgenetics.com/faqs/#prenatal

Genes in the Hereditary Gastrointestinal Cancer Panel and their clinical significance
Gene Associated phenotypes Inheritance ClinVar HGMD
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 546 1856
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 646 923
AXIN2 Oligodontia-colorectal cancer syndrome AD 6 14
BLM Bloom syndrome AR 83 91
BMPR1A* Polyposis, juvenile intestinal AD 65 119
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2448 2175
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 2771 2045
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 13 25
CDH1 CDH1-related cancer AD 103 182
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 69 218
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 20 69
FANCC Fanconi anemia AR 63 45
GREM1 Hereditary mixed polyposis syndrome AD/AR 6
HNF1A Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis AD 61 511
KIT Gastrointestinal stromal tumor AD 73 109
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 219 714
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 748 1119
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 803 1147
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 480 472
MUTYH Familial adenomatous polyposis,, Colorectal adenomatous polyposis, with pilomatricomas AR 97 144
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 592 2681
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 317 274
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 196 284
POLD1 Colorectal cancer AD 3 21
POLE Colorectal cancer, Facial dysmorphism, immunodeficiency, livedo, and short stature syndrome (FILS syndrome) AD/AR 8 29
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 329 599
RHBDF2 Tylosis with esophageal cancer AD 2 3
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 123 259
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 23 56
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome AD 56 160
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 139 132
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome AD 22 115
STK11 Peutz-Jeghers syndrome AD 135 412
TMEM127 Pheochromocytoma AD 20 40
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 340 405
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 106 336
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 260 1093
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 170 594

*Some regions of the gene are duplicated in the genome leading to limited sensitivity within the regions. Thus, low-quality variants are filtered out from the duplicated regions and only high-quality variants confirmed by other methods are reported out. Read more.

Gene, refers to HGNC approved gene symbol; Inheritance to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR) and X-linked (XL); ClinVar, refers to a number of variants in the gene classified as pathogenic or likely pathogenic in ClinVar (http://www.ncbi.nlm.nih.gov/clinvar/); HGMD, refers to a number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD, http://www.hgmd.cf.ac.uk/ac/). The list of associated (gene specific) phenotypes are generated from CDG (http://research.nhgri.nih.gov/CGD/) or Orphanet (http://www.orpha.net/) databases.

Gene Genomic location HG19 HGVS RefSeq RS-number
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043220 c.-195A>C NM_001127511.2
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
CDKN2A Chr9:21974860 c.-34G>T NM_000077.4 rs1800586
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47635062 c.212-478T>G NM_000251.2 rs587779138
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744

The strengths of this test include:

  • Blueprint Genetics is one of the few laboratories worldwide with CAP and ISO-15189 accreditation for NGS panels and CLIA certification
  • Superior sequencing quality
  • Careful selection of genes based on current literature, our experience and the most current mutation databases
  • Transparent and easy access to quality and performance data at the patient level that are accessible via our Nucleus portal
  • Transparent and reproducible analytical validation for each panel (see Test performance section; for complete details, see our Analytic Validation)
  • Sequencing and high resolution del/dup analysis available in one test
  • Inclusion of non-coding disease causing variants where clinically indicated (please see individual Panel descriptions)
  • Interpretation of variants following ACMG variant classification guidelines
  • Comprehensive clinical statement co-written by a PhD geneticist and a clinician specialist

 

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Variants in regulatory or non-coding regions of the gene unless otherwise indicated (please see Non-coding disease causing variants covered by the panel). This mean for instance intronic variants locating deeper than 15 nucleotides from the exon-intron boundary.

 

This test may not reliably detect the following:

  • Low level mosaicism
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Disorders caused by long repetitive sequences (e.g. trinucleotide repeat expansions)

 

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

Blueprint Genetics offers a comprehensive Hereditary Gastrointestinal Cancer Panel that covers classical genes associated with APC-related attenuated familial adenomatous polyposis, ataxia telangiectasia, Carney-Stratakis syndrome, Cowden syndrome, familial adenomatous polyposis, familial pancreatic cancer, gastrointestinal cancer, gastrointestinal stromal tumor, generalized juvenile polyposis/juvenile polyposis coli, hereditary breast and ovarian cancer syndrome, hereditary diffuse gastric cancer, Li-Fraumeni syndrome, lynch syndrome, MUTYH-related attenuated familial adenomatous polyposis, palmoplantar keratoderma-esophageal carcinoma syndrome, Peutz-Jeghers syndrome and Von Hippel-Lindau disease. The genes are carefully selected based on the existing scientific evidence, our experience and most current mutation databases. Candidate genes are excluded from this first-line diagnostic test. The test does not recognise balanced translocations or complex inversions, and it may not detect low-level mosaicism. The test should not be used for analysis of sequence repeats or for diagnosis of disorders caused by mutations in the mitochondrial DNA.

Analytical validation is a continuous process at Blueprint Genetics. Our mission is to improve the quality of the sequencing process and each modification is followed by our standardized validation process. Average sensitivity and specificity in Blueprint NGS Panels is 99.3% and 99.9% for detecting SNPs. Sensitivity to for indels vary depending on the size of the alteration: 1-10bps (96.0%), 11-20 bps (88.4%) and 21-30 bps (66.7%). The longest detected indel was 46 bps by sequence analysis. Detection limit for Del/Dup (CNV) analysis varies through the genome depending on exon size, sequencing coverage and sequence content. The sensitivity is 71.5% for single exon deletions and duplications and 99% for three exons’ deletions and duplications. We have validated the assays for different starting materials including EDTA-blood, isolated DNA (no FFPE) and saliva that all provide high-quality results. The diagnostic yield varies substantially depending on the used assay, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be cost-effective first line test if your patient’s phenotype is suggestive for a specific mutation profile.

The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. The highest relevance in the reported variants is achieved through elimination of false positive findings based on variability data for thousands of publicly available human reference sequences and validation against our in-house curated mutation database as well as the most current and relevant human mutation databases. Reference databases currently used are the 1000 Genomes Project (http://www.1000genomes.org), the NHLBI GO Exome Sequencing Project (ESP; http://evs.gs.washington.edu/EVS), the Exome Aggregation Consortium (ExAC; http://exac.broadinstitute.org), ClinVar database of genotype-phenotype associations (http://www.ncbi.nlm.nih.gov/clinvar) and the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk). The consequence of variants in coding and splice regions are estimated using the following in silico variant prediction tools: SIFT (http://sift.jcvi.org), Polyphen (http://genetics.bwh.harvard.edu/pph2/), and Mutation Taster (http://www.mutationtaster.org).

Through our online ordering and statement reporting system, Nucleus, the customer can access specific details of the analysis of the patient. This includes coverage and quality specifications and other relevant information on the analysis. This represents our mission to build fully transparent diagnostics where the customer gains easy access to crucial details of the analysis process.

In addition to our cutting-edge patented sequencing technology and proprietary bioinformatics pipeline, we also provide the customers with the best-informed clinical report on the market. Clinical interpretation requires fundamental clinical and genetic understanding. At Blueprint Genetics our geneticists and clinicians, who together evaluate the results from the sequence analysis pipeline in the context of phenotype information provided in the requisition form, prepare the clinical statement. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals, even without training in genetics.

Variants reported in the statement are always classified using the Blueprint Genetics Variant Classification Scheme modified from the ACMG guidelines (Richards et al. 2015), which has been developed by evaluating existing literature, databases and with thousands of clinical cases analyzed in our laboratory. Variant classification forms the corner stone of clinical interpretation and following patient management decisions. Our statement also includes allele frequencies in reference populations and in silico predictions. We also provide PubMed IDs to the articles or submission numbers to public databases that have been used in the interpretation of the detected variants. In our conclusion, we summarize all the existing information and provide our rationale for the classification of the variant.

A final component of the analysis is the Sanger confirmation of the variants classified as likely pathogenic or pathogenic. This does not only bring confidence to the results obtained by our NGS solution but establishes the mutation specific test for family members. Sanger sequencing is also used occasionally with other variants reported in the statement. In the case of variant of uncertain significance (VUS) we do not recommend risk stratification based on the genetic finding. Furthermore, in the case VUS we do not recommend use of genetic information in patient management or genetic counseling. For some cases Blueprint Genetics offers a special free of charge service to investigate the role of identified VUS.

We constantly follow genetic literature adapting new relevant information and findings to our diagnostics. Relevant novel discoveries can be rapidly translated and adopted into our diagnostics without delay. These processes ensure that our diagnostic panels and clinical statements remain the most up-to-date on the market.

Find more info in Support

Choose an analysis method

$ $ 1700
$ $ 1000
$ $ 1900
Total $
Order now

ICD & CPT codes

CPT codes

SEQ 81479
DEL/DUP 81479

Accepted sample types

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 5μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Subscribe to our newsletter