Hereditary Melanoma and Skin Cancer Panel

Last modified: Mar 21, 2018


  • Is a 19 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of an inherited susceptibility to melanoma and skin cancer. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.

Analysis methods

  • PLUS
  • SEQ


3-4 weeks

Number of genes


Test code


CPT codes

SEQ 81214
SEQ 81216
SEQ 81405
DEL/DUP 81479


The Blueprint Genetics Hereditary Melanoma and Skin Cancer Panel (test code ON0501):

  • Is a 19 gene panel that includes assessment of selected non-coding disease-causing variants
  • Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

  • Is available as PLUS analysis (sequencing analysis and deletion/duplication analysis), sequencing analysis only or deletion/duplication analysis only

Test Specific Strength

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

ICD codes

Commonly used ICD-10 code(s) when ordering the Hereditary Melanoma and Skin Cancer Panel

ICD-10 Disease
C43.9 Melanoma
Z12.83 Skin cancer

Sample Requirements

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 3μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Cancers arising in the skin include basal-cell cancer, squamous cell cancer, and melanoma. Melanomas may rarely also occur in the mouth, intestines or eye. Ultraviolet radiation from exposure to sun light or tanning beds is the main cause for skin cancer. A subset of skin cancers is associated with various hereditary cancer syndromes. Familial atypical multiple mole melanoma syndrome is caused by mutations in the CDKN2A gene that may be present in up to 40% of the familial cases of melanoma. Mutations in the CDK4 gene also cause familial melanoma predisposition. Gorlin syndrome is associated with pathogenic mutations in the PTCH1 and SUFU genes and increases the risk of developing basal cell carcinomas. Other cancer susceptibility syndromes/genes that increase the risk of developing skin cancers, either as a primary or secondary disease, include BAP1-related tumor predisposition syndrome (BAP1), hereditary breast and ovarian cancer syndrome (BRCA1 and BRCA2), xeroderma pigmentosum (several genes), MITF-related melanoma and renal cell carcinoma predisposition syndrome (MITF), Li-Fraumeni syndrome (TP53), Cowden syndrome (PTEN), and Werner syndrome (WRN).

Genes in the Hereditary Melanoma and Skin Cancer Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
BAP1 Tumor predisposition syndrome AD 33 94
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2448 2175
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 2771 2045
CDK4 Melanoma, cutaneous malignant AD 4 11
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 69 218
DDB2 Xeroderma pigmentosum AR 4 15
ERCC2 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 22 86
ERCC3 Xeroderma pigmentosum, Trichothiodystrophy, photosensitive AR 10 17
ERCC4 Fanconi anemia, Xeroderma pigmentosum AR 11 43
ERCC5 Xeroderma pigmentosum, Xeroderma pigmentosum/Cockayne syndrome AR 18 51
MITF Renal cell carcinoma with or without malignant melanoma, Tietz albinism-deafness syndrome, Waardenburg syndrome, Melanoma, cutaneous malignant AD 24 55
POT1 Glioma susceptibility 9, Melanoma, cutaneous malignant, susceptibility to 10 AD 2 28
PTCH1 Basal cell nevus syndrome AD 122 397
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 329 599
SUFU Medulloblastoma, Basal cell nevus syndrome AD 12 25
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 340 405
WRN* Werner syndrome AR 25 102
XPA Xeroderma pigmentosum AR 14 44
XPC Xeroderma pigmentosum AR 19 86

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by the panel

Gene Genomic location HG19 HGVS RefSeq RS-number
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41196977 c.*718A>G NM_007294.3
BRCA1 Chr17:41196895 c.*800T>C NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
CDKN2A Chr9:21974860 c.-34G>T NM_000077.4 rs1800586
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21972311 c.151-1104C>G NM_000077.4
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89622883–89623482
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4
XPA Chr9:100449555 c.390-12A>G NM_000380.3
XPC Chr3:14187285 c.*156G>A NM_004628.4 rs121965092
XPC Chr3:14209904 c.413-24A>G NM_004628.4 rs794729657

Added and removed genes from the panel

Genes added Genes removed

Test strength

Assesses for non-coding disease causing variants in one or more genes, including promoter variants in PTEN.

The strengths of this test include:
  • CAP and ISO-15189 accreditations covering all operations at Blueprint Genetics including all Whole Exome Sequencing, NGS panels and confirmatory testing
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publically available analytic validation demonstrating complete details of test performance
  • 1479 non-coding disease causing variants in Blueprint WES assay (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification based on modified ACMG variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test limitations

Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics hereditary melanoma and skin cancer panel covers classical genes associated with Gorlin syndrome, Hereditary breast and ovarian cancer syndrome, Werner syndrome, Cowden syndrome, Li-Fraumeni syndrome 1, Familial atypical multiple mole melanoma syndrome, melanoma, skin cancer, BAP1-related tumor predisposition syndrome, Basal cell nevus syndrome, familial melanoma, MITF-related melanoma and renal cell carcinoma predisposition syndrome, retinoblastoma and xeroderma pigmentosum complementation. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics Whole Exome Sequencing (WES) assay. All individual panels are sliced from WES data.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.65% (412,456/413,893) >99.99%
Insertions, deletions and indels by sequence analysis
1-10 bps 96.94% (17,070/17,608) >99.99%
11-50 bps 99.07% (957/966) >99.99%
Copy number variants (exon level dels/dups)
Clinical samples (small CNVs, n=52)
1 exon level deletion 92.3% (24/26) NA
2 exons level deletion/duplication 100.0% (11/11) NA
3-7 exons level deletion/duplication 93.3% (14/15) NA
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
Simulated CNV detection
2 exons level deletion/duplication 90.98% (7,357/8,086) 99.96%
5 exons level deletion/duplication 98.63% (7,975/8,086) 99.98%
The performance presented above reached by WES with the following coverage metrics
Mean sequencing depth at exome level 174x
Nucleotides with >20x sequencing coverage (%) 99.4%


The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling all of the following criteria are not Sanger confirmed: 1) the variant quality score is above the internal threshold for a true positive call, 2) an unambiguous IGV in-line with the variant call and 3) previous Sanger confirmation of the same variant at least three times at Blueprint Genetics. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation databases to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling. For eligible cases, Blueprint Genetics offers a no charge service to investigate the role of reported VUS (VUS Clarification Service).

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.