Hereditary Paraganglioma-Pheochromocytoma Panel

Last modified: Jun 12, 2018


  • Is a 11 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a personal history suggestive of an inherited susceptibility to paragangliomas and/or pheochromocytomas or patients with a family history suggestive of an inherited susceptibility to paragangliomas and/or pheochromocytomas. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue.

Analysis methods

  • PLUS
  • SEQ


3-4 weeks

Number of genes


Test code


Panel size


CPT codes

SEQ 81405
SEQ 81406
SEQ 81437
DEL/DUP 81479


The Blueprint Genetics Hereditary Paraganglioma-Pheochromocytoma Panel (test code ON1201):

  • Is a 11 gene panel that includes assessment of selected non-coding disease-causing variants
  • Is available as PLUS analysis (sequencing analysis and deletion/duplication analysis), sequencing analysis only or deletion/duplication analysis only

ICD codes

Commonly used ICD-10 code(s) when ordering the Hereditary Paraganglioma-Pheochromocytoma Panel

ICD-10 Disease
C75.0 Hereditary paraganglioma-pheochromocytoma

Sample Requirements

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 3μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Hereditary paraganglioma/pheochromocytoma (PGL/PCC) is a genetic condition that is characterized by the presence of tumors originating from the neuroendocrine tissue. Paragangliomas are tumors that are often found in the head and neck and arise in the cellular structures called the paraganglia. Pheochromocytomas are located outside of the head and neck and specifically develop in the paraganglia of the adrenal glands. Hereditary PGL/PCC patients tend to develop multifocal (multiple tumors arising from the same anatomical location) and bilateral (tumors found in symmetrical organ sites) disease. The majority of the pathogenic mutations associated with the development of PGL/PCC are found in the NF1, RET, SDHB, SDHD and VHL genes. Recently, pathogenic germline mutations in FH have been found in patients with PGL/PCC. These syndromes are characterized by reduced penetrance and the outcome varies depending on the affected gene. The risk for malignant transformation is greater for extra-adrenal sympathetic paragangliomas than for pheochromocytomas or skull base and neck paragangliomas. The prevalence of hereditary paraganglioma-pheochromocytoma is 1:100,000.

Genes in the Hereditary Paraganglioma-Pheochromocytoma Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 156 205
MAX Pheochromocytoma AD 11 25
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 810 2703
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 84 402
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 42 58
SDHAF2 Paragangliomas AD 3 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 138 262
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 26 57
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 62 164
TMEM127 Pheochromocytoma AD 25 41
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 188 595

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by the panel

Gene Genomic location HG19 HGVS RefSeq RS-number
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744

Added and removed genes from the panel

Genes added Genes removed

Test strength

The strengths of this test include:
  • CAP and ISO-15189 accreditations covering all operations at Blueprint Genetics including all Whole Exome Sequencing, NGS panels and confirmatory testing
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publically available analytic validation demonstrating complete details of test performance
  • ~1,500 non-coding disease causing variants in Blueprint WES assay (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification based on modified ACMG variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test limitations

Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics hereditary paraganglioma-Pheochromocytoma panel covers classical genes associated with Carney-Stratakis syndrome, multiple endocrine neoplasia type 2, Von Hippel-Lindau disease, hereditary paraganglioma-pheochromocytoma and neurofibromatosis type 1. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics Whole Exome Sequencing (WES) assay. All individual panels are sliced from WES data.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.65% (412,456/413,893) >99.99%
Insertions, deletions and indels by sequence analysis
1-10 bps 96.94% (17,070/17,608) >99.99%
11-50 bps 99.07% (957/966) >99.99%
Copy number variants (exon level dels/dups)
Clinical samples (small CNVs, n=52)
1 exon level deletion 92.3% (24/26) NA
2 exons level deletion/duplication 100.0% (11/11) NA
3-7 exons level deletion/duplication 93.3% (14/15) NA
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
Simulated CNV detection
2 exons level deletion/duplication 90.98% (7,357/8,086) 99.96%
5 exons level deletion/duplication 98.63% (7,975/8,086) 99.98%
The performance presented above reached by WES with the following coverage metrics
Mean sequencing depth at exome level 174x
Nucleotides with >20x sequencing coverage (%) 99.4%


The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling all of the following criteria are not Sanger confirmed: 1) the variant quality score is above the internal threshold for a true positive call, 2) an unambiguous IGV in-line with the variant call and 3) previous Sanger confirmation of the same variant at least three times at Blueprint Genetics. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation databases to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling. For eligible cases, Blueprint Genetics offers a no charge service to investigate the role of reported VUS (VUS Clarification Service).

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.