Hereditary Pediatric Cancer Panel

Summary
  • Is a 71 gene panel that includes assessment of non-coding variants.
  • Is ideal for patients with a clinical suspicion of an inherited or a sporadic pediatric cancer syndrome due to de novo mutation. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue. The genes on this panel are included in the Comprehensive Hereditary Cancer Panel.

Analysis methods
  • PLUS
Availability

4 weeks

Number of genes

71

Test code

ON0801

Panel size

Large

CPT code *
See below **
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.
** CPT coding is dependent on patient history and payer being billed.

Summary

The Blueprint Genetics Hereditary Pediatric Cancer Panel (test code ON0801):

ICD codes

Commonly used ICD-10 code(s) when ordering the Hereditary Pediatric Cancer Panel

ICD-10 Disease
Q82.2 Bloom syndrome
Q87.3 Beckwith-Wiedemann syndrome
Q87.89 Gorlin syndrome
D48.9 Li-Fraumeni syndrome
Q85.8 Peutz-Jeghers syndrome
Q82.8 Rothmund-Thomson syndrome
Q87.3 Simpson-Golabi-Behmel syndrome
E34.8 Werner syndrome
Q85.8 Von Hippel-Lindau disease
C18.0 Hereditary nonpolyposis colon cancer
D12.6 Juvenile polyposis syndrome
C71.9 Medulloblastoma predisposition
D44.9 Multiple endocrine neoplasia
C64.9 Nephroblastoma
Q85.1 Tuberous sclerosis complex
D12.6 Familial adenomatous polyposis
C75.0 Hereditary paraganglioma-pheochromocytoma
Q85.00 Neurofibromatosis type 1
Q85.00 Neurofibromatosis type 2

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Childhood leukemia is the most common pediatric cancer and accounts for more than a third of all new cancer diagnoses in children and adolescents. Most cancers occurring in children are thought to be sporadic and a genetic predisposition is rarely implicated. However, a small proportion of childhood leukemia and solid tumors are caused by hereditary cancer syndromes. The hereditary cancers that occur commonly in children include Wilms tumor (WT1) and medulloblastoma (SUFU). The main forms of hereditary cancer syndromes affecting children, adolescents, and young adults are Li-Fraumeni syndrome (TP53), hereditary pheochromocytoma-paraganglioma (SDH genes), pleuropulmonaryblastoma tumor predisposition syndrome (DICER1), rhabdoid tumor of the kidney (SMARCB1) and multiple endocrine neoplasia (MEN1 and RET). In particular, when children present with adult type cancers, such as skin or gastrointestinal tract cancer, an underlying genetic predisposition should be suspected. The risk of developing cancer in individuals carrying pathogenic germline mutations varies but can be as high as 80% for SDH and 100% for RET mutation carriers. Genetic testing for pediatric cancer patients has important implications for screening, prevention and treatment.

Genes in the Hereditary Pediatric Cancer Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ALK Neuroblastoma AD 31 15
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 773 1926
AXIN2 Oligodontia-colorectal cancer syndrome, Oligondontia, isolated AD 19 18
BAP1 Tumor predisposition syndrome AD 74 113
BLM Bloom syndrome AR 152 119
BMPR1A* Polyposis, juvenile intestinal AD 110 140
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 134 65
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 14 28
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 24 43
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 50 101
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CEBPA Acute myeloid leukemia, familial AD 15 13
DICER1* DICER1 syndrome AD 197 137
DIS3L2* Perlman syndrome AR 12 14
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 38 80
EZH2 Weaver syndrome AD 29 41
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 178 207
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 30 142
GPC3 Simpson-Golabi-Behmel syndrome XL 33 75
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LZTR1 Schwannomatosis, Noonan syndrome AD/AR 34 71
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MAX Pheochromocytoma AD 13 31
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 263 730
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 873 1191
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 933 1249
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 672 586
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NF2 Schwannomatosis, Neurofibromatosis AD 66 433
NRAS Noonan syndrome AD 31 14
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 329 517
NSUN2 Dubowitz syndrome, Non-syndromic intellectual disability AD/AR 8 7
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 11 86
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 319 342
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 24 183
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PTCH1 Basal cell nevus syndrome AD 193 522
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 435 638
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 45 53
RASA2 Noonan syndrome AD 1 3
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
REST Fibromatosis, gingival, 5 AD 3 16
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 122 407
RIT1 Noonan syndrome AD 23 26
RRAS Noonan-syndrome like phenotype AD/AR 2
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 54 87
SDHAF2 Paragangliomas AD 4 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 151 272
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 29 60
SDHD# Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 68 170
SHOC2 Noonan-like syndrome with loose anagen hair AD 2 4
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMARCA4 Rhabdoid tumor predisposition syndrome AD 76 57
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 AD 36 118
SOS1 Noonan syndrome AD 44 71
SOS2 Noonan syndrome 9 AD 4 6
STK11 Peutz-Jeghers syndrome AD 173 460
SUFU Medulloblastoma, Basal cell nevus syndrome AD 22 44
TMEM127 Pheochromocytoma AD 30 52
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 393 505
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 177 372
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 396 1195
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 206 614
WRN* Werner syndrome AR 64 107
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 AD 42 183

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Hereditary Pediatric Cancer Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
APC Chr5:112043009–112043595
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043223 c.-192A>G NM_001127511.2 rs879253784
APC Chr5:112043223 c.-192A>T NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112072710–112073585
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
BAP1 Chr3:52435659 c.*644delG NM_004656.3
BUB1B Chr15:40409289 c.-44133G>A NM_001211.5 rs576524605
BUB1B Chr15:40504689 c.2386-11A>G NM_001211.5 rs751421137
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
DICER1 Chr14:95559038 c.5364+1187T>G NM_177438.2
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
LZTR1 Chr22:21336623 c.-38T>A NM_006767.3
LZTR1 Chr22:21350968 c.2220-17C>A NM_006767.3 rs1249726034
MEN1 Chr11:64571394 c.*412G>A NM_000244.3
MEN1 Chr11:64575165 c.670-15_670-14delTC NM_000244.3
MEN1 Chr11:64577602 c.-23-11_-22delTTGCCTTGCAGGC NM_000244.3
MEN1 Chr11:64577603 c.-23_-22insT NM_000244.3
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NSUN2 Chr5:6622224 c.538-11T>G NM_017755.5
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89622883–89623482
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623392 c.-835C>T NM_000314.4 rs587779994
PTEN Chr10:89623428 c.-799G>C NM_000314.4 rs587779992
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89690791 c.210-8dupT NM_000314.4
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTEN Chr10:89725294 c.*65T>A NM_000314.4
PTEN Chr10:89725304 c.*75_*92delTAATGGCAATAGGACATTinsCTATGGCAATAGGACATTG NM_000314.4
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
REST Chr4:57793760 c.983-2247C>G NM_005612.4
RET Chr10:43572670 c.-37G>C NM_020975.4 rs751005619
RET Chr10:43572680 c.-27C>G NM_020975.4
RET Chr10:43582162 c.73+9385_73+9395delAGCAACTGCCA NM_020975.4 rs368137511
RET Chr10:43606948 c.1522+35C>T NM_020975.4 rs377130948
RET Chr10:43612192 c.2284+13C>T NM_020975.4
RET Chr10:43612198 c.2284+19C>T NM_020975.4
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
SMARCB1 Chr22:24130008 c.93+559A>G NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
STK11 Chr19:1220520 c.597+16_597+33delGGGGGGCCCTGGGGCGCCinsTG NM_000455.4
STK11 Chr19:1220530 c.598-32_597+31delGCCCCCTCCCGGGC NM_000455.4
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TSC1 Chr9:135800306 c.363+668G>A NM_000368.4
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
TSC2 Chr16:2106052 c.600-145C>T NM_000548.3
TSC2 Chr16:2107460 c.848+281C>T NM_000548.3 rs45517132
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
VHL Chr3:10183471 c.-54_-44dupTCCGACCCGCG NM_000551.3
VHL Chr3:10191719 c.*70C>A NM_000551.3
VHL Chr3:10191719 c.*70C>T NM_000551.3 rs552290225
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4

Test Strengths

The strengths of this test include:
  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: SDHD (NM_001276506:4). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Other

Subscribe to our newsletter

Subscribe