Hereditary Pediatric Cancer Panel

Last modified: Jun 12, 2018

Summary

  • Is a 71 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of an inherited or a sporadic pediatric cancer syndrome due to de novo mutation. This panel is designed to detect heritable germline mutations and should not be used for the detection of somatic mutations in tumor tissue. The genes on this panel are included in the Comprehensive Hereditary Cancer Panel.

Analysis methods

  • PLUS
  • SEQ
  • DEL/DUP

Availability

3-4 weeks

Number of genes

71

Test code

ON0801

Panel size

Large

CPT codes

SEQ 81201
SEQ 81405
SEQ 81406
DEL/DUP 81479

Summary

The Blueprint Genetics Hereditary Pediatric Cancer Panel (test code ON0801):

  • Is a 71 gene panel that includes assessment of selected non-coding disease-causing variants
  • Is available as PLUS analysis (sequencing analysis and deletion/duplication analysis), sequencing analysis only or deletion/duplication analysis only

Sample Requirements

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 3μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Childhood leukemia is the most common pediatric cancer and accounts for more than a third of all new cancer diagnoses in children and adolescents. Most cancers occurring in children are thought to be sporadic and a genetic predisposition is rarely implicated. However, a small proportion of childhood leukemia and solid tumors are caused by hereditary cancer syndromes. The hereditary cancers that occur commonly in children include Wilms tumor (WT1) and medulloblastoma (SUFU). The main forms of hereditary cancer syndromes affecting children, adolescents, and young adults are Li-Fraumeni syndrome (TP53), hereditary pheochromocytoma-paraganglioma (SDH genes), pleuropulmonaryblastoma tumor predisposition syndrome (DICER1), rhabdoid tumor of the kidney (SMARCB1) and multiple endocrine neoplasia (MEN1 and RET). In particular, when children present with adult type cancers, such as skin or gastrointestinal tract cancer, an underlying genetic predisposition should be suspected. The risk of developing cancer in individuals carrying pathogenic germline mutations varies but can be as high as 80% for SDH and 100% for RET mutation carriers. Genetic testing for pediatric cancer patients has important implications for screening, prevention and treatment.

Genes in the Hereditary Pediatric Cancer Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ALK Neuroblastoma AD 29 15
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 672 1907
AXIN2 Oligodontia-colorectal cancer syndrome, Oligondontia, isolated AD 10 18
BAP1 Tumor predisposition syndrome AD 52 106
BLM Bloom syndrome AR 91 107
BMPR1A* Polyposis, juvenile intestinal AD 87 135
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous syndrome AD 135 65
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 12 27
CBL Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia AD 23 38
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 42 90
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 28 81
CEBPA Acute myeloid leukemia, familial AD 15 10
DICER1* DICER1 syndrome AD 177 126
DIS3L2* Perlman syndrome AR 10 11
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 26 75
EZH2 Weaver syndrome AD 29 40
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 156 205
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency AD 26 105
GPC3 Simpson-Golabi-Behmel syndrome XL 29 72
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 41 29
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 61 34
LZTR1 Schwannomatosis, Noonan syndrome AD 27 64
MAP2K1 Cardiofaciocutaneous syndrome AD 45 21
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MAX Pheochromocytoma AD 11 25
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 239 726
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 829 1174
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 874 1224
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 580 569
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 141 87
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 810 2703
NF2 Schwannomatosis, Neurofibromatosis AD 47 428
NRAS Noonan syndrome AD 31 14
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 303 515
NSUN2 Dubowitz syndrome, Non-syndromic intellectual disability AD/AR 8 7
PAX5 Pre-B cell acute lymphoblastic leukemia AD 5
PHOX2B Central hypoventilation syndrome, congenital, Neuroblastoma, susceptiblity to, Neuroblastoma with Hirschsprung disease AD 10 80
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 259 324
PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, Hemophagocytic lymphohistiocytosis AR 22 172
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 66 180
PTCH1 Basal cell nevus syndrome AD 147 411
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 398 627
PTPN11 Noonan syndrome, Metachondromatosis AD 128 139
RAF1 LEOPARD syndrome, Noonan syndrome, Dilated cardiomyopathy (DCM) AD 44 48
RASA2# Noonan syndrome AD 1 3
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 53 100
REST Fibromatosis, gingival, 5 AD 3 15
RET Hirschsprung disease, Central hypoventilation syndrome, congenital, Pheochromocytoma, Medullary thyroid carcinoma, Multiple endocrine neoplasia AD/AR 84 402
RIT1 Noonan syndrome AD 20 25
RRAS Noonan-syndrome like phenotype AD/AR 2
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 25 92
SDHA* Leigh syndrome/Mitochondrial respiratory chain complex II deficiency, Gastrointestinal stromal tumor, Paragangliomas, Dilated cardiomyopathy (DCM), Cardiomyopathy, dilated, 1GG AD/AR 42 58
SDHAF2 Paragangliomas AD 3 5
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 138 262
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 26 57
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome, Mitochondrial complex II deficiency AD 62 164
SHOC2 Noonan-like syndrome with loose anagen hair AD 2 4
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 162 141
SMARCA4 Rhabdoid tumor predisposition syndrome AD 55 55
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome AD 31 116
SOS1 Noonan syndrome AD 45 67
SOS2 Noonan syndrome 9 AD 3 6
STK11 Peutz-Jeghers syndrome AD 149 436
SUFU Medulloblastoma, Basal cell nevus syndrome AD 15 38
TMEM127 Pheochromocytoma AD 25 41
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 372 481
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 138 346
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 322 1137
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 188 595
WRN* Werner syndrome AR 36 103
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor, Nephrotic syndrome, type 4 AD 36 175

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by the panel

Gene Genomic location HG19 HGVS RefSeq RS-number
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043220 c.-195A>C NM_001127511.2
APC Chr5:112043009–112043595
APC Chr5:112072710–112073585
APC Chr5:112158419 c.1408+731C>T NM_000038.5
APC Chr5:112158423 c.1408+735A>T NM_000038.5
APC Chr5:112111315 c.423-11A>G NM_000038.5
APC Chr5:112111314 c.423-12A>G NM_000038.5
APC Chr5:112115546 c.532-941G>A NM_000038.5 rs730881227
APC Chr5:112151175 c.835-17A>G NM_000038.5
BUB1B Chr15:40409289 c.-44133G>A NM_001211.5 rs576524605
BUB1B Chr15:40504689 c.2386-11A>G NM_001211.5 rs751421137
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
LZTR1 Chr22:21340117 c.264-13G>A NM_006767.3 rs587777176
MEN1 Chr11:64577626 c.-23-22C>A NM_000244.3
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37053487 c.589-9_589-6delGTTT NM_000249.3 rs752286654,rs587779026
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47635062 c.212-478T>G NM_000251.2 rs587779138
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF2 Chr22:30050946 c.516+232G>A NM_000268.3
NSUN2 Chr5:6622224 c.538-11T>G NM_017755.5
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTCH1 Chr9:98226337 c.2561-2057A>G NM_000264.3
PTEN Chr10:89623226 c.-1001T>C NM_000314.4
PTEN Chr10:89623116 c.-1111A>G NM_000314.6
PTEN Chr10:89623056 c.-1171C>T NM_000314.6 rs587779981
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623373 c.-854C>G NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
PTEN Chr10:89622883–89623482
PTEN Chr10:89623049 c.-1178C>T NM_000314.6
PTEN Chr10:89622988 c.-1239A>G NM_000314.6
PTEN Chr10:89623331 c.-896T>C NM_000314.4
PTEN Chr10:89623306 c.-921G>T NM_000314.4
PTEN Chr10:89623296 c.-931G>A NM_000314.4 rs587781959
PTEN Chr10:89692749 c.254-21G>C NM_000314.4
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RET Chr10:43613947 c.2392+19T>C NM_020975.4 rs778745375
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
TMEM127 Chr2:96931137 c.-18C>T NM_017849.3 rs121908813
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
TSC2 Chr16:2127477 c.2838-122G>A NM_000548.3
TSC2 Chr16:2138031 c.5069-18A>G NM_000548.3 rs45484794
TSC2 Chr16:2110656 c.976-15G>A NM_000548.3 rs45517150
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744
WRN Chr8:30966107 c.2089-3024A>G NM_000553.4 rs281865157
WRN Chr8:30999982 c.3234-160A>G NM_000553.4

Added and removed genes from the panel

Genes added Genes removed
BRAF
BUB1B
CBL
KRAS
LZTR1
MAP2K1
MAP2K2
NRAS
NSUN2
PAX5
PTPN11
RAF1
RASA2
REST
RIT1
RRAS
SHOC2
SMARCA4
SOS1
SOS2
RB1

Test strength

The strengths of this test include:
  • CAP and ISO-15189 accreditations covering all operations at Blueprint Genetics including all Whole Exome Sequencing, NGS panels and confirmatory testing
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publically available analytic validation demonstrating complete details of test performance
  • ~1,500 non-coding disease causing variants in Blueprint WES assay (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification based on modified ACMG variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: PMS2 (15), RASA2 (3, 6, 17, 19, 20). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics hereditary pediatric cancer panel covers classical genes associated with Bloom syndrome, Beckwith-Wiedemann syndrome, Gorlin syndrome, Li-Fraumeni syndrome, Peutz-Jeghers syndrome, Rothmund-Thomson syndrome, Simpson-Golabi-Behmel syndrome, Werner syndrome, Von Hippel-Lindau disease, pediatric cancer, hereditary nonpolyposis colon cancer, Juvenile polyposis syndrome, medulloblastoma predisposition, multiple endocrine neoplasia, nephroblastoma, Pleuropulmonary blastoma family tumor susceptibility syndrome, tuberous sclerosis complex, familial adenomatous polyposis, hereditary paraganglioma-pheochromocytoma, neurofibromatosis type 1 and neurofibromatosis type 2. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics Whole Exome Sequencing (WES) assay. All individual panels are sliced from WES data.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.65% (412,456/413,893) >99.99%
Insertions, deletions and indels by sequence analysis
1-10 bps 96.94% (17,070/17,608) >99.99%
11-50 bps 99.07% (957/966) >99.99%
Copy number variants (exon level dels/dups)
Clinical samples (small CNVs, n=52)
1 exon level deletion 92.3% (24/26) NA
2 exons level deletion/duplication 100.0% (11/11) NA
3-7 exons level deletion/duplication 93.3% (14/15) NA
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
Simulated CNV detection
2 exons level deletion/duplication 90.98% (7,357/8,086) 99.96%
5 exons level deletion/duplication 98.63% (7,975/8,086) 99.98%
     
The performance presented above reached by WES with the following coverage metrics
     
Mean sequencing depth at exome level 174x
Nucleotides with >20x sequencing coverage (%) 99.4%

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling all of the following criteria are not Sanger confirmed: 1) the variant quality score is above the internal threshold for a true positive call, 2) an unambiguous IGV in-line with the variant call and 3) previous Sanger confirmation of the same variant at least three times at Blueprint Genetics. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation databases to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling. For eligible cases, Blueprint Genetics offers a no charge service to investigate the role of reported VUS (VUS Clarification Service).

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

General resources