Hereditary Pancreatic Cancer Panel

  • bpg-method PLUS
  • bpg-method SEQ
  • bpg-method DEL/DUP

Test code: ON0301

The Blueprint Genetics Hereditary Pancreatic Cancer Panel analyzes 22 genes associated with inherited susceptibility to pancreatic cancer.

The Panel is suited for detecting heritable germline mutations and may not be used for the detection of somatic mutations in tumor tissue. This panel is included in the Hereditary Gastrointestinal Cancer Panel and Comprehensive Hereditary Cancer Panel.

About Hereditary Pancreatic Cancer

Pancreatic ductal carcinoma makes up the vast majority (90%) of all pancreatic neoplasms, and remains a disease with very poor prognosis and high morbidity. Familial aggregation has been recognized in approximately 10% of pancreatic cancers. Familial pancreatic cancer is defined as a family with at least one pair of first-degree relatives (parent-child or sibling pair) with pancreatic cancer without an identifiable syndrome in the family. Inherited pancreatic cancer is genetically highly heterogenous and has been associated with germline mutations in ATM, BRCA2, CDKN2A, PALB2 and BUB1B, among others (PMID: 26658419). Increased susceptibility to pancreatic cancer may also be associated with different cancer syndromes, such as hereditary breast and ovarian cancer syndrome, Lynch syndrome, ataxia telangiectasia, and familial adenomatous polyposis (PMID: 23187834). Genetic diagnosis of familial pancreatic cancer offers opportunities for personalized therapies (PMID: 25719666).

Availability

Results in 3-4 weeks. We do not offer a maternal cell contamination (MCC) test at the moment. We offer prenatal testing only for cases where the maternal cell contamination studies (MCC) are done by a local genetic laboratory. Read more: http://blueprintgenetics.com/faqs/#prenatal

Genes in the Hereditary Pancreatic Cancer Panel and their clinical significance
Gene Associated phenotypes Inheritance ClinVar HGMD
APC Gardner syndrome, Desmoid disease, hereditary, Familial adenomatous polyposis AD 294 1780
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 455 853
BMPR1A* Polyposis, juvenile intestinal AD 38 108
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2207 2054
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic cancer, Wilms tumor, Breast-ovarian cancer, familial AD/AR 2514 1791
BUB1B Mosaic variegated aneuploidy syndrome, Premature chromatid separation trait AD/AR 12 22
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 37 217
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 15 63
FANCC Fanconi anemia AR 34 34
MEN1 Hyperparathyroidism, familial primary, Multiple endocrine neoplasia AD 124 699
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 670 1084
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 646 1089
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 308 426
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 261 2607
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 237 223
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 151 266
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 119 128
STK11 Peutz-Jeghers syndrome AD 69 399
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 148 391
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 61 306
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 141 977
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 143 573

*Some regions of the gene are duplicated in the genome leading to limited sensitivity within the regions. Thus, low-quality variants are filtered out from the duplicated regions and only high-quality variants confirmed by other methods are reported out. Read more.

Gene, refers to HGNC approved gene symbol; Inheritance to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR) and X-linked (XL); ClinVar, refers to a number of variants in the gene classified as pathogenic or likely pathogenic in ClinVar (http://www.ncbi.nlm.nih.gov/clinvar/); HGMD, refers to a number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD, http://www.hgmd.cf.ac.uk/ac/). The list of associated (gene specific) phenotypes are generated from CDG (http://research.nhgri.nih.gov/CGD/) or Orphanet (http://www.orpha.net/) databases.

Gene Genomic location HG19 HGVS RefSeq RS-number Comment Reference
APC Chr5:112043289 c.-125delA NM_001127511.2
APC Chr5:112043225 c.-190G>A NM_001127511.2
APC Chr5:112043224 c.-191T>C NM_001127511.2
APC Chr5:112043223 c.-192A>G/T NM_001127511.2
APC Chr5:112043220 c.-195A>C NM_001127511.2
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
CDKN2A Chr9:21974860 c.-34G>T NM_000077.4 rs1800586
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47635062 c.212-478T>G NM_000251.2 rs587779138
NF1 Chr17:29577934 c.4110+1802delA NM_001042492.2 rs863224944
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744

The strengths of this test include:

  • Blueprint Genetics is one of the few laboratories worldwide with CAP and ISO-15189 accreditation for NGS panels and CLIA certification
  • Superior sequencing quality
  • Careful selection of genes based on current literature, our experience and the most current mutation databases
  • Transparent and easy access to quality and performance data at the patient level that are accessible via our Nucleus portal
  • Transparent and reproducible analytical validation for each panel (see Test performance section; for complete details, see our Analytic Validation)
  • Sequencing and high resolution del/dup analysis available in one test
  • Inclusion of non-coding disease causing variants where clinically indicated (please see individual Panel descriptions)
  • Interpretation of variants following ACMG variant classification guidelines
  • Comprehensive clinical statement co-written by a PhD geneticist and a clinician specialist

 

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Variants in regulatory or non-coding regions of the gene unless otherwise indicated (please see Non-coding disease causing variants covered by the panel). This mean for instance intronic variants locating deeper than 15 nucleotides from the exon-intron boundary.

 

This test may not reliably detect the following:

  • Low level mosaicism
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Disorders caused by long repetitive sequences (e.g. trinucleotide repeat expansions)

 

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

Blueprint Genetics offers a comprehensive Hereditary Pancreatic Cancer Panel that covers classical genes associated with ataxia telangiectasia, familial adenomatous polyposis, familial pancreatic cancer, hereditary breast and ovarian cancer syndrome, Li-Fraumeni syndrome, lynch syndrome, pancreatic cancer, Peutz-Jeghers syndrome and Von Hippel-Lindau disease. The genes are carefully selected based on the existing scientific evidence, our experience and most current mutation databases. Candidate genes are excluded from this first-line diagnostic test. The test does not recognise balanced translocations or complex inversions, and it may not detect low-level mosaicism. The test should not be used for analysis of sequence repeats or for diagnosis of disorders caused by mutations in the mitochondrial DNA.

Analytical validation is a continuous process at Blueprint Genetics. Our mission is to improve the quality of the sequencing process and each modification is followed by our standardized validation process. Average sensitivity and specificity in Blueprint NGS Panels is 99.3% and 99.9% for detecting SNPs. Sensitivity to for indels vary depending on the size of the alteration: 1-10bps (96.0%), 11-20 bps (88.4%) and 21-30 bps (66.7%). The longest detected indel was 46 bps by sequence analysis. Detection limit for Del/Dup (CNV) analysis varies through the genome depending on exon size, sequencing coverage and sequence content. The sensitivity is 71.5% for single exon deletions and duplications and 99% for three exons’ deletions and duplications. We have validated the assays for different starting materials including EDTA-blood, isolated DNA (no FFPE) and saliva that all provide high-quality results. The diagnostic yield varies substantially depending on the used assay, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be cost-effective first line test if your patient’s phenotype is suggestive for a specific mutation profile.

The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. The highest relevance in the reported variants is achieved through elimination of false positive findings based on variability data for thousands of publicly available human reference sequences and validation against our in-house curated mutation database as well as the most current and relevant human mutation databases. Reference databases currently used are the 1000 Genomes Project (http://www.1000genomes.org), the NHLBI GO Exome Sequencing Project (ESP; http://evs.gs.washington.edu/EVS), the Exome Aggregation Consortium (ExAC; http://exac.broadinstitute.org), ClinVar database of genotype-phenotype associations (http://www.ncbi.nlm.nih.gov/clinvar) and the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk). The consequence of variants in coding and splice regions are estimated using the following in silico variant prediction tools: SIFT (http://sift.jcvi.org), Polyphen (http://genetics.bwh.harvard.edu/pph2/), and Mutation Taster (http://www.mutationtaster.org).

Through our online ordering and statement reporting system, Nucleus, the customer can access specific details of the analysis of the patient. This includes coverage and quality specifications and other relevant information on the analysis. This represents our mission to build fully transparent diagnostics where the customer gains easy access to crucial details of the analysis process.

In addition to our cutting-edge patented sequencing technology and proprietary bioinformatics pipeline, we also provide the customers with the best-informed clinical report on the market. Clinical interpretation requires fundamental clinical and genetic understanding. At Blueprint Genetics our geneticists and clinicians, who together evaluate the results from the sequence analysis pipeline in the context of phenotype information provided in the requisition form, prepare the clinical statement. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals, even without training in genetics.

Variants reported in the statement are always classified using the Blueprint Genetics Variant Classification Scheme modified from the ACMG guidelines (Richards et al. 2015), which has been developed by evaluating existing literature, databases and with thousands of clinical cases analyzed in our laboratory. Variant classification forms the corner stone of clinical interpretation and following patient management decisions. Our statement also includes allele frequencies in reference populations and in silico predictions. We also provide PubMed IDs to the articles or submission numbers to public databases that have been used in the interpretation of the detected variants. In our conclusion, we summarize all the existing information and provide our rationale for the classification of the variant.

A final component of the analysis is the Sanger confirmation of the variants classified as likely pathogenic or pathogenic. This does not only bring confidence to the results obtained by our NGS solution but establishes the mutation specific test for family members. Sanger sequencing is also used occasionally with other variants reported in the statement. In the case of variant of uncertain significance (VUS) we do not recommend risk stratification based on the genetic finding. Furthermore, in the case VUS we do not recommend use of genetic information in patient management or genetic counseling. For some cases Blueprint Genetics offers a special free of charge service to investigate the role of identified VUS.

We constantly follow genetic literature adapting new relevant information and findings to our diagnostics. Relevant novel discoveries can be rapidly translated and adopted into our diagnostics without delay. These processes ensure that our diagnostic panels and clinical statements remain the most up-to-date on the market.

Find more info in Support

Choose an analysis method

$ $ 1400
$ $ 1000
$ $ 1600
Total $
Order now

ICD & CPT codes

CPT codes

SEQ 81479
DEL/DUP 81479

Accepted sample types

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 5μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Subscribe to our newsletter