Hereditary Renal Cancer Panel

PLUSbpg-method SEQbpg-method DEL/DUPbpg-method

Test code: ON1501

The Blueprint Genetics Hereditary Renal Cancer Panel analyzes 25 genes associated with inherited suscebtibility to renal cancer.

Syndromes that contribute to increased risk of developing renal tumors have predominantly autosomal dominant inheritance pattern. Around 2-3% of renal cell cancer cases are accounted for by hereditary syndromes. The Hereditary Renal Cancer Panel is suited for detecting heritable germline mutations and may not be used for the detection of somatic mutations in tumor tissue. This Panel is part of the Comprehensive Hereditary Cancer Panel.

About Hereditary Renal Cancer

The main inherited forms of renal cell cancer and the associated genes include von Hippel-Lindau disease (VHL), hereditary papillary renal cancer (MET), hereditary leiomyomatosis and renal cancer (FH), familial renal cancer (BAP1), Birt-Hogg-Dube syndrome (FLCN), and renal cancer associated with tuberous sclerosis (TSC1, TSC2). In general, hereditary renal cancer cases present with earlier age of onset and are more likely to involve bilateral tumors while other neoplasms may also occur. The risk of developing renal cancer associated with these syndromes varies but can be as high as 67% for patients with hereditary papillary renal cancer. Germline mutations in WT1 are associated with Wilms tumor that is one of the most common solid tumors of childhood, occurring in 1 in 10,000 children and accounting for 8% of childhood cancers. Prevalence of individual hereditary renal cancer syndromes varies from very rare to 3:100 000.


Results in 3-4 weeks. We do not offer a maternal cell contamination (MCC) test at the moment. We offer prenatal testing only for cases where the maternal cell contamination studies (MCC) are done by a local genetic laboratory. Read more:

Genes in the Hereditary Renal Cancer Panel and their clinical significance
Gene Associated phenotypes Inheritance ClinVar HGMD
BAP1 Tumor predisposition syndrome AD 13 73
CDC73 Carcinoma, parathyroid, Hyperparathyroidism, Hyperparathyroidism-jaw tumor syndrome AD 23 86
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 25 79
DICER1* DICER1 syndrome AD 96 109
DIS3L2* Perlman syndrome AR 6 9
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, hereditary nonpolyposis AD/AR 15 63
FH Hereditary leiomyomatosis and renal cell cancer AD/AR 89 161
FLCN Birt-Hogg-Dube syndrome, Pneumothorax, primary spontaneous AD 85 165
GPC3 Simpson-Golabi-Behmel syndrome XL 22 65
HNF1A Maturity onset diabetes of the young, Renal cell carcinoma, nonpapillary clear cell, Liver adenomatosis AD 47 505
MET Deafness, Renal cell carcinoma, papillary AD/AR 13 23
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 670 1084
MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, hereditary nonpolyposis,, Mismatch repair cancer syndrome AD/AR 646 1089
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 308 426
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary nonpolyposis AD/AR 151 266
PTEN* Bannayan-Riley-Ruvalcaba syndrome, Lhermitte-Duclos syndrome, Cowden syndrome AD 192 564
SDHB Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Gastrointestinal stromal tumor, Paragangliomas, Cowden-like syndrome AD 72 249
SDHC Paraganglioma and gastric stromal sarcoma, Gastrointestinal stromal tumor, Paragangliomas AD 14 53
SDHD Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Paragangliomas, Carcinoid tumors, intestinal, Cowden syndrome AD 42 158
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome AD 17 115
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma AD 148 391
TSC1 Lymphangioleiomyomatosis, Tuberous sclerosis AD 61 306
TSC2 Lymphangioleiomyomatosis, Tuberous sclerosis AD 141 977
VHL Erythrocytosis, familial, Pheochromocytoma AD/AR 143 573
WT1 Denys-Drash syndrome, Frasier syndrome, Wilms tumor AD 23 165

*Some regions of the gene are duplicated in the genome leading to limited sensitivity within the regions. Thus, low-quality variants are filtered out from the duplicated regions and only high-quality variants confirmed by other methods are reported out. Read more.

Gene, refers to HGNC approved gene symbol; Inheritance to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR) and X-linked (XL); ClinVar, refers to a number of variants in the gene classified as pathogenic or likely pathogenic in ClinVar (; HGMD, refers to a number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD, The list of associated (gene specific) phenotypes are generated from CDG ( or Orphanet ( databases.

Gene Genomic location HG19 HGVS RefSeq RS-number Comment Reference
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47635062 c.212-478T>G NM_000251.2 rs587779138
PTEN Chr10:89623462 c.-765G>A NM_000314.4
PTEN Chr10:89623365 c.-862G>T NM_000314.4 rs587776675
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
TSC2 Chr16:2098067 c.-30+1G>C NM_000548.3 rs587778004
VHL Chr3:10183453 c.-75_-55delCGCACGCAGCTCCGCCCCGCG NM_000551.3 rs727503744

Blueprint Genetics offers a comprehensive Hereditary Renal Cancer Panel that covers classical genes associated with Birt-Hogg-Dube syndrome, hereditary leiomyomatosis and renal cell cancer, hereditary papillary renal cancer, hereditary paraganglioma-pheochromocytoma, renal cancer, tuberous sclerosis and Von Hippel-Lindau disease. The genes are carefully selected based on the existing scientific evidence, our experience and most current mutation databases. Candidate genes are excluded from this first-line diagnostic test. The test does not recognise balanced translocations or complex inversions, and it may not detect low-level mosaicism. The test should not be used for analysis of sequence repeats or for diagnosis of disorders caused by mutations in the mitochondrial DNA.

Analytical validation is a continuous process at Blueprint Genetics. Our mission is to improve the quality of the sequencing process and each modification is followed by our standardized validation process. Average sensitivity and specificity in Blueprint NGS Panels is 99.3% and 99.9% for detecting SNPs. Sensitivity to for indels vary depending on the size of the alteration: 1-10bps (96.0%), 11-20 bps (88.4%) and 21-30 bps (66.7%). The longest detected indel was 46 bps by sequence analysis. Detection limit for Del/Dup (CNV) analysis varies through the genome depending on exon size, sequencing coverage and sequence content. The sensitivity is 71.5% for single exon deletions and duplications and 99% for three exons’ deletions and duplications. We have validated the assays for different starting materials including EDTA-blood, isolated DNA (no FFPE) and saliva that all provide high-quality results. The diagnostic yield varies substantially depending on the used assay, referring healthcare professional, hospital and country. Blueprint Genetics’ Plus Analysis (Seq+Del/Dup) maximizes the chance to find molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be cost-effective first line test if your patient’s phenotype is suggestive for a specific mutation profile.

The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. The highest relevance in the reported variants is achieved through elimination of false positive findings based on variability data for thousands of publicly available human reference sequences and validation against our in-house curated mutation database as well as the most current and relevant human mutation databases. Reference databases currently used are the 1000 Genomes Project (, the NHLBI GO Exome Sequencing Project (ESP;, the Exome Aggregation Consortium (ExAC;, ClinVar database of genotype-phenotype associations ( and the Human Gene Mutation Database ( The consequence of variants in coding and splice regions are estimated using the following in silico variant prediction tools: SIFT (, Polyphen (, and Mutation Taster (

Through our online ordering and statement reporting system, Nucleus, the customer can access specific details of the analysis of the patient. This includes coverage and quality specifications and other relevant information on the analysis. This represents our mission to build fully transparent diagnostics where the customer gains easy access to crucial details of the analysis process.

In addition to our cutting-edge patented sequencing technology and proprietary bioinformatics pipeline, we also provide the customers with the best-informed clinical report on the market. Clinical interpretation requires fundamental clinical and genetic understanding. At Blueprint Genetics our geneticists and clinicians, who together evaluate the results from the sequence analysis pipeline in the context of phenotype information provided in the requisition form, prepare the clinical statement. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals, even without training in genetics.

Variants reported in the statement are always classified using the Blueprint Genetics Variant Classification Scheme modified from the ACMG guidelines (Richards et al. 2015), which has been developed by evaluating existing literature, databases and with thousands of clinical cases analyzed in our laboratory. Variant classification forms the corner stone of clinical interpretation and following patient management decisions. Our statement also includes allele frequencies in reference populations and in silico predictions. We also provide PubMed IDs to the articles or submission numbers to public databases that have been used in the interpretation of the detected variants. In our conclusion, we summarize all the existing information and provide our rationale for the classification of the variant.

A final component of the analysis is the Sanger confirmation of the variants classified as likely pathogenic or pathogenic. This does not only bring confidence to the results obtained by our NGS solution but establishes the mutation specific test for family members. Sanger sequencing is also used occasionally with other variants reported in the statement. In the case of variant of uncertain significance (VUS) we do not recommend risk stratification based on the genetic finding. Furthermore, in the case VUS we do not recommend use of genetic information in patient management or genetic counseling. For some cases Blueprint Genetics offers a special free of charge service to investigate the role of identified VUS.

We constantly follow genetic literature adapting new relevant information and findings to our diagnostics. Relevant novel discoveries can be rapidly translated and adopted into our diagnostics without delay. These processes ensure that our diagnostic panels and clinical statements remain the most up-to-date on the market.

Find more info in Support

Like this:

Download PDF

Choose an analysis method

$ $ 1400
$ $ 1000
$ $ 1600
Total $
Order now

ICD & CPT codes

CPT codes

SEQ 81479
DEL/DUP 81479

Accepted sample types

  • EDTA blood, min. 1 ml
  • Purified DNA, min. 5μg
  • Saliva (Oragene DNA OG-500 kit)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue.

Subscribe to our newsletter