Comprehensive Skeletal Dysplasias and Disorders Panel

Summary
Is a 411 gene panel that includes assessment of non-coding variants.

Is ideal for patients with a clinical suspicion of disorders involving the skeletal system.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
411
Test code
MA3301
Panel tier
Tier 3
CPT Code *
81236, 81403 x2, 81404 x3, 81405 x9, 81406 x11, 81407 x3, 81408 x5, 81479
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Comprehensive Skeletal Dysplasias and Disorders Panel (test code MA3301):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

This panel includes a pathogenic intronic variant that is often missed by exome sequencing: *IFITM5* c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). The remainder of *IFITM5* is not covered at this time.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

This panel covers a broad spectrum of skeletal disorders including common and rare skeletal dysplasias (eg. achondroplasia, COL2A1 related dysplasias, diastrophic dysplasia, various types of spondylo-metaphyseal dysplasias), various ciliopathies with skeletal involvement (eg. short rib-polydactylies, asphyxiating thoracic dysplasia dysplasias and Ellis-van Creveld syndrome), various subtypes of osteogenesis imperfecta, campomelic dysplasia, slender bone dysplasias, dysplasias with multiple joint dislocations, chondrodysplasia punctata group of disorders, neonatal osteosclerotic dysplasias, osteopetrosis and related disorders, abnormal mineralization group of disorders (eg hypopohosphatasia), osteolysis group of disorders, disorders with disorganized development of skeletal components, overgrowth syndromes with skeletal involvement, craniosynostosis syndromes, dysostoses with predominant craniofacial involvement, dysostoses with predominant vertebral involvement, patellar dysostoses, brachydactylies, some disorders with limb hypoplasia-reduction defects, ectrodactyly with and without other manifestations, polydactyly-syndactyly-triphalangism group of disorders, and disorders with defects in joint formation and synostoses.

Genes in the Comprehensive Skeletal Dysplasias and Disorders Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ACAN# Spondyloepimetaphyseal dysplasia, aggrecan type, Spondyloepiphyseal dysplasia, Kimberley type, Osteochondritis dissecans, short stature, and early-onset osteoarthritis AD/AR 20 56
ACP5 Spondyloenchondrodysplasia with immune dysregulation AR 12 26
ACVR1 Fibrodysplasia ossificans progressiva AD 14 19
ADAMTS10 Weill-Marchesani syndrome AR 8 14
ADAMTS17 Weill-Marchesani-like syndrome AR 6 7
ADAMTSL2#* Geleophysic dysplasia 3 AR 8 28
AGA Aspartylglucosaminuria AR 48 37
AGPS Rhizomelic chondrodysplasia punctata type 3 AR 4 8
AIFM1 Deafness, Combined oxidative phosphorylation deficiency 6, Cowchock syndrome XL 27 31
AKT1 Proteus syndrome, Cowden syndrome AD 5 6
ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, juvenile and adult forms AD/AR 78 291
ALX1 Frontonasal dysplasia 3 AR 1 5
ALX3 Frontonasal dysplasia type 1 AR 8 8
ALX4 Frontonasal dysplasia type 2, Parietal foramina AD/AR 15 24
AMER1 Osteopathia striata with cranial sclerosis XL 14 40
ANKH Calcium pyrophosphate deposition disease (familial chondrocalcinosis type 2), Craniometaphyseal dysplasia autosomal dominant type AD 13 20
ANKRD11* KBG syndrome AD 142 132
ANO5 Gnathodiaphyseal dysplasia, LGMD2L and distal MMD3 muscular dystrophies AD/AR 64 121
ANTXR2 Hyalinosis, infantile systemic, Fibromatosis, juveline hyaline AR 17 47
ARCN1 Rhizomelic short stature with microcephaly, micrognathia, and developmental delay (SRMMD) AD 3 3
ARHGAP31 Adams-Oliver syndrome AD 3 6
ARID1B Coffin-Siris syndrome, Intellectual developmental disorder AD 153 185
ARSB Mucopolysaccharidosis (Maroteaux-Lamy) AR 118 201
ARSE* Chondrodysplasia punctata X-linked recessive, brachytelephalangic type (CDPX1) XL 22 46
ATP6V0A2 Cutis laxa, Wrinkly skin syndrome AR 16 56
ATR Cutaneous telangiectasia and cancer syndrome, Seckel syndrome AD/AR 10 33
B3GALT6# Spondyloepimetaphyseal dysplasia with joint laxity, Ehlers-Danlos syndrome AR 17 27
B3GAT3#* Multiple joint dislocations, short stature, craniofacial dysmorphism, and congenital heart defects AR 6 13
B4GALT7 Ehlers-Danlos syndrome, progeroid form AR 8 9
BGN Spondyloepimetaphyseal dysplasia, X-linked, Meester-Loeys syndrome XL 8 7
BHLHA9 Syndactyly Malik-Percin type, mesoaxial synostotic, with phalangeal reduction, Split hand-foot malformation with long bone deficiency (SHFLD3), Gollop-Wolfgang AR 4 43
BMP1 Osteogenesis imperfecta AR 7 21
BMP2 Brachydactyly type A2 AD 5 28
BMPER Diaphanospondylodysostosis AR 6 19
BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH) AD/AR 12 23
C21ORF2 Retinal dystrophy with or without macular staphyloma (RDMS), Spondylometaphyseal dysplasia, axial (SMDAX) AR 13 22
C2CD3 Orofaciodigital syndrome XIV AR 9 10
CA2 Osteopetrosis, with renal tubular acidosis AR 9 31
CANT1 Desbuquois dysplasia, Epiphyseal dysplasia, multiple AR 20 28
CASR Hypocalcemia, Neonatal hyperparathyroidism, Familial Hypocalciuric hypercalcemia with transient Neonatal hyperparathyroidism AD/AR 104 396
CC2D2A# COACH syndrome, Joubert syndrome, Meckel syndrome AR 76 91
CDC45 Meier-Gorlin syndrome 7 AR 10 19
CDC6 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 2 2
CDH3 Hypotrichosis, congenital, with juvenile macular dystrophy, Ectodermal dysplasia, ectrodactyly, and macular dystrophy syndrome AR 7 30
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CDT1 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 6 12
CENPE Microcephaly 13, primary, autosomal recessive AD/AR 3 4
CEP120 Short-rib thoracic dysplasia 13 with or without polydactyly AR 9 9
CEP152 Seckel syndrome, Microcephaly AR 20 20
CEP290* Bardet-Biedl syndrome, Leber congenital amaurosis, Joubert syndrome, Senior-Loken syndrome, Meckel syndrome AR 130 289
CHST14 Ehlers-Danlos syndrome, musculocontractural AR 15 21
CHST3 Spondyloepiphyseal dysplasia with congenital joint dislocations (recessive Larsen syndrome) AR 18 37
CHSY1 Temtamy preaxial brachydactyly syndrome AR 6 16
CKAP2L Filippi syndrome AR 7 7
CLCN5 Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease XL 48 272
CLCN7 Osteopetrosis AD/AR 15 98
COG1 Congenital disorder of glycosylation AR 4 3
COG4 Congenital disorder of glycosylation AD/AR 12 4
COL10A1 Metaphyseal chondrodysplasia, Schmid AD 21 53
COL11A1 Marshall syndrome, Fibrochondrogenesis, Stickler syndrome type 2, Deafness AD/AR 34 94
COL11A2 Weissenbacher-Zweymuller syndrome, Deafness, Otospondylomegaepiphyseal dysplasia, Fibrochondrogenesis, Stickler syndrome type 3 (non-ocular) AD/AR 29 57
COL1A1 Ehlers-Danlos syndrome, Caffey disease, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD 352 962
COL1A2 Ehlers-Danlos syndrome, cardiac valvular form, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD/AR 186 509
COL27A1 Steel syndrome AR 7 7
COL2A1 Avascular necrosis of femoral head, Rhegmatogenous retinal detachment, Epiphyseal dysplasia, with myopia and deafness, Czech dysplasia, Achondrogenesis type 2, Platyspondylic dysplasia Torrance type, Hypochondrogenesis, Spondyloepiphyseal dysplasia congenital (SEDC), Spondyloepimetaphyseal dysplasia (SEMD) Strudwick type, Kniest dysplasia, Spondyloperipheral dysplasia, Mild SED with premature onset arthrosis, SED with metatarsal shortening, Stickler syndrome type 1 AD 180 561
COL9A1 Multiple epiphyseal dysplasia type 6 (EDM6), Stickler syndrome, type IV AD/AR 9 6
COL9A2 Stickler syndrome, Multiple epiphyseal dysplasia type 2 (EDM2) AD/AR 7 12
COL9A3 Multiple epihyseal dysplasia type 3 (EDM3), Stickler syndrome recessive type AD/AR 10 14
COMP Pseudoachondroplasia, Multiple epiphyseal dysplasia AD 43 186
CREB3L1 Osteogenesis imperfecta, type XVI AD/AR 2 3
CREBBP Rubinstein-Taybi syndrome AD 175 362
CRIPT Short stature with microcephaly and distinctive facies AR 4 4
CRLF1 Crisponi syndrome, Cold-induced sweating syndrome, type 1 AR 21 37
CRTAP Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 12 30
CSF1R Leukoencephalopathy, diffuse hereditary, with spheroids AD 56 83
CSPP1 Jeune asphyxiating thoracic dystrophy, Joubert syndrome AR 32 27
CTSA Galactosialidosis AR 17 38
CTSK Pycnodysostosis AR 35 58
CUL7 3-M syndrome, Yakut short stature syndrome AR 26 83
CYP27B1 Vitamin D-dependent rickets AR 23 73
CYP2R1 Vitamin D hydroxylation deficient rickets, type 1B AR 2 6
DDR2 Spondylometaepiphyseal dysplasia, short limb-hand type AR 11 9
DDX58 Singleton-Merten syndrome AD 4 3
DHCR24 Desmosterolosis AR 6 9
DHODH Postaxial acrofacial dysostosis (Miller syndrome) AR 8 20
DLL3 Spondylocostal dysostosis AR 12 26
DLL4 Adams-Oliver syndrome AD 13 14
DLX3 Amelogenesis imperfecta, Trichodontoosseous syndrome AD 5 11
DLX5 Split-hand/foot malformation with sensorineural hearing loss, Split-hand/foot malformation AD/AR 3 9
DMP1 Hypophosphatemic rickets AR 5 10
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNMT3A Tatton-Brown-Rahman syndrome AD 41 48
DOCK6 Adams-Oliver syndrome AR 21 21
DONSON Microcephaly, short stature, and limb abnormalities (MISSLA), Microcephaly-Micromelia syndrome AR 10 19
DSE* Ehlers-Danlos syndrome, musculocontractural type 2 AR 4 3
DVL1 Robinow syndrome AD 17 19
DVL3 Robinow syndrome, autosomal dominant 3 AD 6 12
DYM Dyggve-Melchior-Clausen dysplasia, Smith-McCort dysplasia AR 22 34
DYNC2H1 Short -rib thoracic dysplasia with or without polydactyly type 1, Short -rib thoracic dysplasia with or without polydactyly type 3, Asphyxiating thoracic dysplasia (ATD; Jeune), SRPS type 2 (Majewski) AR/Digenic 148 205
DYNC2LI1 Short-rib thoracic dysplasia 15 with polydactyly AR 19 14
EBP Chondrodysplasia punctata, Male EBP disorder with neurologic defects (MEND) XL 43 90
EDN1 Question-mark ears, isolated, Auriculocondylar Syndrome 3 AD/AR 4 7
EDNRA Mandibulofacial dysostosis with alopecia AD 2 4
EFL1* Shwachman-Diamond syndrome 3 2
EFNB1 Craniofrontonasal dysplasia XL 28 116
EFTUD2 Mandibulofacial dysostosis with microcephaly, Esophageal atresia, syndromic AD 45 99
EIF2AK3 SED, Wolcott-Rallison type AR 9 80
EIF4A3 Richieri-Costa-Pereira Syndrome AR 4 2
ENAM Amelogenesis imperfecta AD/AR 8 18
ENPP1 Arterial calcification, Hypophosphatemic rickets AD/AR 22 72
EOGT Adams-Oliver syndrome AR 8 5
EP300 Rubinstein-Taybi syndrome AD 63 101
ERF Craniosynostosis 4, Chitayat syndrome AD 17 16
ESCO2 SC phocomelia syndrome, Roberts syndrome AR 30 31
EVC Weyers acrofacial dysostosis, Ellis-van Creveld syndrome AD/AR 58 83
EVC2 Ellis-van Creveld syndrome, Weyers acrodental dysostosis AD/AR 78 75
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
EXT2 Multiple cartilagenious exostoses 2, Seizures, scoliosis, and macrocephaly syndrome AD/AR 45 250
EXTL3 Immunoskeletal dysplasia with neurodevelopmental abnormalities (ISDNA) AR 4 8
EZH2 Weaver syndrome AD 29 41
FAM111A Kenny-Caffey syndrome, type 2 AD 5 9
FAM20A Amelogenesis imperfecta (Enamel-renal syndrome) AR 19 41
FAM20C Hypophosphatemia, hyperphosphaturia, dental anomalies, intracerebral calcifications and osteosclerosis (Raine syndrome) AR 13 25
FAM46A Osteogenesis imperfecta AR 3 3
FAM83H Amelogenesis imperfecta AD 14 32
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 3 AD 1465 2679
FBN2 Congenital contractural arachnodactyly (Beals syndrome) AD 50 97
FERMT3 Leukocyte adhesion deficiency AR 8 14
FGF10 Aplasia of lacrimal and salivary glands AD 15 13
FGF23 Tumoral calcinosis, hyperphosphatemic, Hypophosphatemic rickets AD/AR 10 17
FGF9 Multiple synostoses syndrome 3 AD 2 2
FGFR1 Pfeiffer syndrome, Trigonocephaly, Hypogonadotropic hypogonadism, Osteoglophonic Dwarfism - Craniostenosis, Hartsfield syndrome AD/Digenic/Multigenic 72 257
FGFR2 Apert syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome, Lacrimoauriculodentodigital syndrome, Beare-Stevenson cutis gyrata syndrome, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Craniofacial-skeletal-dermatological dysplasia, Crouzon syndrome, Bent bone dysplasia AD 100 154
FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN AD/AR 54 77
FIG4 Amyotrophic lateral sclerosis, Polymicrogyria, bilateral occipital, Yunis-Varon syndrome, Charcot-Marie-Tooth disease AD/AR 34 69
FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44
FKBP14 Ehlers-Danlos syndrome with progressive kyphoscoliosis, myopathy, and hearing loss AR 5 6
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects, Periventricular nodular heterotopia 1, Melnick-Needles syndrome, Intestinal pseudoobstruction, neuronal, X-linked/Congenital short bowel syndrome, Cardiac valvular dysplasia, X-linked XL 133 257
FLNB Larsen syndrome (dominant), Atelosteogenesis type 1, Atelosteogenesis type 3, Spondylo-carpal-tarsal dyspasia, Boomerang dysplasia AD/AR 43 121
FN1 Glomerulopathy with fibronectin deposits 2 AD 14 25
FTO Growth retardation, developmental delay, and facial dysmorphism AR 3 7
FUCA1 Fucosidosis AR 19 33
FZD2 4 7
GALNS Mucopolysaccharidosis (Morquio syndrome) AR 53 334
GALNT3 Tumoral calcinosis, hyperphosphatemic AR 17 35
GCM2 Hypoparathyroidism, familial isolated, Hyperparathyroidism 4 AD/AR 9 20
GDF3 Microphthalmia, isolated 7, Microphthalmia, isolated, with coloboma 6, Klippel-Feil syndrome 3, autosomal dominant, Coloboma, ocular AD 5 6
GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia AD/AR 23 53
GDF6 Microphthalmia, isolated 4, Microphthalmia, isolated, with coloboma 6, Coloboma, ocular, Klippel-Feil syndrome 1, autosomal dominant, Leber congenital amaurosis 17 AD/AR 9 21
GJA1* Oculodentodigital dysplasia mild type, Oculodentodigital dysplasia severe type, Syndactyly type 3 AD/AR 31 107
GLB1 GM1-gangliosidosis, Mucopolysaccharidosis (Morquio syndrome) AR 90 220
GLI3 Acrocallosal syndrome, Pallister-Hall syndrome, Grieg cephalopolysndactyly syndrome, Postaxial polydactyly type A, Preaxial polydactyly type 3, Preaxial polydactyly type 4 AD 70 235
GMNN Meier-Gorlin syndrome 6 3 3
GNAI3 Auriculocondylar syndrome 1 AD 2 12
GNAS McCune-Albright syndrome, Progressive osseous heteroplasia, Pseudohypoparathyroidism, Albright hereditary osteodystrophy AD 64 274
GNPAT Rhizomelic chondrodysplasia punctata, rhizomelic AR 8 14
GNPTAB Mucolipidosis AR 166 184
GNPTG Mucolipidosis AR 45 46
GNS Mucopolysaccharidosis (Sanfilippo syndrome) AR 7 25
GORAB Geroderma osteodysplasticum AR 8 15
GPC6 Omodysplasia 1 AR 13 9
GSC Short Stature, Auditory-Canal Atresia, Mandibular Hypoplasia, and Skeletal Abnormalities (SAMS) AD/AR 3 7
GUSB* Mucopolysaccharidosis AR 27 62
GZF1 Joint laxity, short stature, and myopia (JLSM) 2 2
HAAO Vertebral, cardiac, renal, and limb defects syndrome 1 2 2
HDAC4 Brachydactyly-intellectual disability syndrome AD 6 16
HDAC8 Cornelia de Lange syndrome XL 41 50
HES7 Spondylocostal dysostosis 4, autosomal recessive AR 5 6
HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1
HOXA13# Hand-foot-uterus syndrome, Hand-foot-genital syndrome, Guttmacher syndrome AD 8 27
HOXD13 Brachydactyly-syndactyly syndrome, Synopolydactyly, Syndactyly, Synopolydactyly with clefting, Brachydactyly type D AD/AR 18 41
HPGD Allelic Digital clubbing, isolated congenital AR 6 14
HRAS Costello syndrome, Congenital myopathy with excess of muscle spindles AD 43 31
HSPA9 Even-Plus syndrome AD/AR 5 13
HSPG2 Schwartz-Jampel syndrome, Dyssegmental dysplasia Silverman-Handmaker type, Dyssegmental dysplasia Rolland-Desbuquis type AR 16 60
IARS2 Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia (CAGSSS) AR 2 7
ICK Endocrine-cerebroosteodysplasia, Epilepsy, juvenile myoclonic AD/AR 1 3
IDH2 D-2-hydroxyglutaric aciduria 2 AD 10 4
IDS* Mucopolysaccharidosis XL 85 637
IDUA Mucopolysaccharidosis AR 105 282
IFIH1 Singleton-Merten syndrome, Aicardi-Goutieres syndrome 7 AD/AR 14 19
IFITM5 Osteogenesis imperfecta type 5 AD 2 2
IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2 AR 13 23
IFT140 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 38 63
IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 22 25
IFT43 Cranioectodermal dysplasia 3 AR 4 7
IFT52 Short-rib thoracic dysplasia 16 with or without polydactyly AR 3 4
IFT57 1 2
IFT80 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 11 11
IFT81# Short rib thoracic dysplasia with polydactyly, Cone-Rod dystrophy, autosomal recessive AR 4 9
IGF2 Growth restriction, severe, with distinctive facies AD 5 7
IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly type Lueken AD/AR 12 32
IL1RN Osteomyelitis, sterile multifocal, with periostitis and pustulosis AR 6 12
IMPAD1 Chondrodysplasia with joint dislocations, GPAPP type AR 5 5
INPPL1 Opsismodysplasia AR 16 32
INTU 4 11
KAT6B Ohdo syndrome, SBBYS variant, Genitopatellar syndrome AD 47 73
KCNJ2 Short QT syndrome, Andersen syndrome, Long QT syndrome, Atrial fibrillation AD 41 93
KIAA0586# Short rib thoracic dysplasia with polydactyly, Joubert syndrome AR 29 31
KIAA0753 Orofaciodigital syndrome XV AR 6 7
KIF22 Spondyloepimetaphyseal dysplasia with joint laxity, type 2 AD 4 4
KIF7 Acrocallosal syndrome, Hydrolethalus syndrome, Al-Gazali-Bakalinova syndrome, Joubert syndrome AR/Digenic 24 44
KL Tumoral calcinosis, hyperphosphatemic AR 1 10
KMT2A Wiedemann-Steiner syndrome AD 117 114
KYNU Hydroxykynureninuria, Vertebral, cardiac, renal, and limb defects syndrome 2 AR 4 7
LBR Pelger-Huet anomaly, Reynolds syndrome, Greenberg/HEM skeletal dysplasia, Hydrops-ectopic calcification-moth-eaten skeletal dysplasia AD/AR 22 24
LEMD3 Buschke-Ollendorff syndrome, Osteopoikilosis AD 13 32
LFNG# Spondylocostal dysostosis, autosomal recessive 3 AR 1 5
LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 syndrome AR 12 32
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
LMX1B Nail-patella syndrome AD 26 194
LONP1 Cerebral, Ocular, Dental, Auricular, and Skeletal anomalies (CODAS) syndrome AR 9 18
LPIN2 Majeed syndrome AR 12 14
LRP4 Cenani-Lenz syndactyly syndrome, Sclerosteosis, Myasthenic syndrome, congenital AD/AR 14 28
LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis AD/AR/Digenic 57 196
LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital AR 21 27
LTBP3 Dental anomalies and short stature, Geleophysic dysplasia 3 AD/AR 15 11
MAFB Multicentric carpotarsal osteolysis AD 13 23
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP3K7 Frontometaphyseal dysplasia 2 AD 12 12
MATN3 Spondyloepimetaphyseal dysplasia Matrilin type, Multiple epiphyseal dysplasia type 5 (EDM5) AD/AR 8 25
MBTPS2 Keratosis follicularis spinulosa decalvans, IFAP syndrome, Palmoplantar keratoderma, mutilating, with periorificial keratotic plaques XL 12 25
MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27
MEGF8 Carpenter syndrome 2 AR 6 14
MEOX1 Klippel-Feil syndrome 2 AR 3 4
MESP2 Spondylocostal dysostosis 2, autosomal recessive AR 18 6
MET Deafness, Renal cell carcinoma, papillary, Osteofibrous dysplasia, susceptibility to AD/AR 20 34
MGP Keutel syndrome AR 5 8
MKS1 Bardet-Biedl syndrome, Meckel syndrome AR 50 52
MMP13 Metaphyseal anadysplasia 1, Metaphyseal dysplasia, Spahr type, Spondyloepimetaphyseal dysplasia, Missouri type AD/AR 7 7
MMP2 Torg-Winchester syndrome, Multicentric osteolysis, nodulosis, and arthropathy AR 8 22
MMP9 Metaphyseal anadysplasia AR 1 7
MNX1# Currarino syndrome AD 16 79
MSX2* Parietal foramina, Parietal foramina with cleidocranial dysplasia, Craniosynostosis Boston type AD 9 25
MYCN Feingold syndrome AD 27 41
MYH3 Arthrogryposis AD/AR 21 45
MYO18B Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism AR 2 4
NANS Spondyloepimetaphyseal dysplasia Genevieve type AR 8 12
NBAS Infantile liver failure syndrome 2, Short stature, optic nerve atrophy, and Pelger-Huet anomaly (SOPH syndrome) AR 23 43
NEK1 Short -rib thoracic dysplasia with or without polydactyly, SRPS type 2 (Majewski) AR/Digenic 22 23
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NFIX Marshall-Smithsyndrome, Sotos syndrome 2 AD 49 78
NIPBL Cornelia de Lange syndrome AD 311 425
NKX3-2 Spondylo-megaepiphyseal-metaphyseal dysplasia AR 4 4
NOG Tarsal-carpal coalition syndrome, Multiple synostosis syndrome, Stapes ankylosis with broad thumb and toes (Teunissen-Cremers syndrome), Symphalangism, proximal, Brachydactyly type B2 AD 20 63
NOTCH1 Aortic valve disease, Adams-Oliver syndrome AD 56 96
NOTCH2* Alagille syndrome, Hajdu-Cheney syndrome AD 37 70
NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities AD/AR 32 75
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 329 517
NSDHL Congenital hemidysplasia with ichthyosiform erythroderma and limb defects (CHILD syndrome), CK syndrome XL 15 28
OBSL1 3-M syndrome AR 13 33
OFD1 Simpson-Golabi-Behmel syndrome, Retinitis pigmentosa, Orofaciodigital syndrome, Joubert syndrome XL 153 160
ORC1 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 9 10
ORC4 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 24 6
ORC6 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 7 6
OSTM1 Osteopetrosis, autosomal recessive 5 AR 5 9
P3H1 Osteogenesis imperfecta AR 18 63
P4HB Cole Carpenter syndrome 1 AD 1 11
PAM16 Spondylometaphyseal dysplasia, Megarbane-Dagher-Melki type AR 1 2
PAPSS2 Brachyolmia 4 with mild epiphyseal and metaphyseal changes, SEMD PAPPS2 type AR 13 20
PAX3 Craniofacial-deafness-hand syndrome, Waardenburg syndrome, type 1, Waardenburg syndrome, type 3 AD/AR 54 149
PCNT Microcephalic osteodysplastic primordial dwarfism AR 49 88
PCYT1A Spondylometaphyseal dysplasia with cone-rod dystrophy AR 12 20
PDE3A Hypertension with brachydactyly AD 7 10
PDE4D Acrodysostosis 2, with or without hormone resistance AD 15 38
PEX5 Adrenoleukodystrophy, neonatal, Rhizomelic chondrodysplasia punctata, Zellweger syndrome, Peroxisome biogenesis disorder AR 8 14
PEX7 Refsum disease, Rhizomelic CDP type 1 AR 44 53
PGM3 Immunodeficiency 23 AR 14 15
PHEX Hypophosphatemic rickets XL 263 437
PIGV Hyperphosphatasia with mental retardation syndrome 1 AR 9 16
PIK3CA* Cowden syndrome, CLOVES AD 85 56
PISD AR
PITX1 Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly, Liebenberg syndrome AD 3 16
PLCB4 Auriculocondylar syndrome 2 AD/AR 14 15
PLEKHM1* Osteopetrosis, autosomal recessive 6, Osteopetrosis AD/AR 3 4
PLOD1 Ehlers-Danlos syndrome AR 30 41
PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23
PLS3 Osteoporosis and osteoporotic fractures XL 1 17
POC1A Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis (SOFT syndrome) AR 4 8
POLR1A Acrofacial dysostosis, Cincinnati type AD 4 4
POLR1C# Treacher Collins syndrome AR 17 21
POLR1D Treacher Collins syndrome AD/AR 9 26
POLR3A Leukodystrophy, hypomyelinating AR 29 91
POLR3B Leukodystrophy, hypomyelinating AD/AR 19 58
POP1 Anauxetic dysplasia 2 AR 5 6
POR Disordered steroidogenesis due to cytochrome p450 oxidoreductase deficiency, Antley-Bixler syndrome AR 14 70
PPIB Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 8 13
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PTDSS1 Lenz-Majewski hyperostotic dwarfism AD 5 7
PTH1R Metaphyseal chondrodysplasia Jansen type, Failure of tooth eruption, Eiken dysplasia, Blomstrand dysplasia AD/AR 13 43
PTHLH Brachydactyly, type E2 AD 5 18
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
PYCR1 Cutis laxa AR type 2B AR 19 38
RAB23 Carpenter syndrome 1 AR 5 15
RAB33B Dyggve-Melchior-Clausen syndrome, Smith-McCort dysplasia 2 AR 6 7
RAD21* Cornelia de Lange syndrome 4 AD 14 11
RBBP8 Seckel syndrome, Jawad syndrome AR 6 6
RBM8A* Thrombocytopenia - absent radius AR 5 12
RBPJ* Adams-Oliver syndrome AD 7 6
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
RIPPLY2 Spondylocostal dysostosis, autosomal recessive 6 AR 2 3
RMRP Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia AR 87 123
RNU4ATAC Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3 AR 15 24
ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40
RPGRIP1L# COACH syndrome, Joubert syndrome, Meckel syndrome, Retinal degeneration in ciliopathy, modifier AR 39 49
RSPRY1 Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type AR 2 2
RUNX2 Cleidocranial dysplasia, Metaphyseal dysplasia with maxillary hypoplasia AD 21 216
SALL1* Townes-Brocks syndrome 1 AD 31 87
SALL4 Acro-renal-ocular syndrome, Duane-radial ray/Okihiro syndrome AD 21 56
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AR 19 90
SC5D Lathosterolosis AR 3 6
SEC24D Cole-Carpenter syndrome 2 AR 4 12
SERPINF1 Osteogenesis imperfecta, type VI AR 9 41
SERPINH1 Osteogenesis imperfecta type 3 AR 3 6
SETBP1 Mental retardation, autosomal dominant 29, Schinzel-Giedion midface retraction syndrome AD 23 46
SETD2 Luscan-Lumish syndrome AD 10 17
SF3B4 Acrofacial dysostosis 1, Nager AD 27 38
SFRP4 Pyle disease AR 3 5
SGMS2 Osteoporosis and osteoporotic fractures, Skeletal dysplasia and disorders AD
SGSH Mucopolysaccharidosis (Sanfilippo syndrome) AR 55 148
SH3BP2 Cherubism AD 9 16
SH3PXD2B Frank-ter Haar syndrome AR 8 20
SHH Holoprosencephaly, Microphthalmia with coloboma AD 42 218
SHOX#* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Short stature XL/PAR 25 431
SKI Shprintzen-Goldberg syndrome AD 20 23
SLC10A7
SLC17A5 Sialuria, Finnish (Salla disease), Infantile sialic acid storage disorder AR 52 54
SLC26A2 Diastrophic dysplasia, Atelosteogenesis type 2, De la Chapelle dysplasia, Recessive Multiple Epiphyseal dysplasia, Achondrogenesis type 1B AR 73 54
SLC29A3 Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis AR 17 25
SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38
SLC35D1 Schneckenbecken dysplasia AR 7 7
SLC39A13 Spondylodysplastic Ehlers-Danlos syndrome AR 2 9
SLCO2A1 Hypertrophic osteoarthropathy AD/AR 13 72
SMAD2 Loeys-Dietz syndrome, Congenital heart defects, nonsyndromic AD 4 13
SMAD3 Aneurysms-osteoarthritis syndrome, Loeys-Dietz syndrome AD 48 82
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMARCA4 Rhabdoid tumor predisposition syndrome AD 76 57
SMARCAL1 Schimke immunoosseous dysplasia AR 20 88
SMARCB1 Schwannomatosis, Rhabdoid tumor predisposition syndrome, Coffin-Siris syndrome 3 AD 36 118
SMARCE1 Coffin-Siris syndrome AD 14 12
SMC1A Cornelia de Lange syndrome XL 73 87
SMC3 Cornelia de Lange syndrome AD 25 21
SNRPB Cerebrocostomandibular syndrome 5 7
SNX10 Osteopetrosis, autosomal recessive 8 AR 3 13
SOST Craniodiaphyseal dysplasia, autosomal dominant, Sclerosteosis 1, van Buchem disease AD/AR 6 14
SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia (Cooks syndrome) AD 47 144
SP7 Osteogenesis imperfecta, type XII AR 2 3
SPARC Keratoconus, Osteogenesis imperfecta, type XVII AR 2 4
SQSTM1 Paget disease of bone, Frontotemporal dementia and/or amyotrophic lateral sclerosis 3, Myopathy, distal, with rimmed vacuoles, Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset AD/AR 10 97
SRP54 Shwachman-Diamond syndrome AD 3
STAMBP Microcephaly-capillary malformation syndrome AR 15 19
SUMF1 Multiple sulfatase deficiency AR 21 53
TAB2 Congenital heart defects, multiple types, 2 AD 13 31
TAPT1 AR 2 3
TBCE Progressive encephalopathy with amyotrophy and optic atrophy (PEAMO) AR 12 8
TBX15 Cousin syndrome AR 2 4
TBX3 Ulnar-Mammary syndrome AD 6 20
TBX4 Small patella syndrome AD/AR 8 58
TBX5 Holt-Oram syndrome AD 61 127
TBX6 Spondylocostal dysostosis 5 AD/AR 9 34
TBXAS1 Ghosal hematodiaphyseal syndrome AR 7 6
TCF12 Craniosynostosis AD 23 56
TCIRG1 Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 48 130
TCOF1 Treacher Collins syndrome AD 50 330
TCTEX1D2 Short-rib thoracic dysplasia 17 with or without polydactyly, Jeune Asphyxiating Thoracic Dystrophy AR 4 6
TCTN3 Orofaciodigital syndrome (Mohr-Majewski syndrome), Joubert syndrome AR 9 12
TGDS Catel-Manzke syndrome AR 6 7
TGFB1 Diaphyseal dysplasia Camurati-Engelmann AD 15 23
TGFB2 Loeys-Dietz syndrome AD 36 38
TGFB3 Loeys-Dietz syndrome (Reinhoff syndrome), Arrhythmogenic right ventricular dysplasia AD 19 26
TGFBR1 Loeys-Dietz syndrome AD 40 69
TGFBR2 Loeys-Dietz syndrome AD 58 139
THPO Thrombocythemia 1 AD/AR 5 10
TMEM165 Congenital disorder of glycosylation AR 4 6
TMEM216 Joubert syndrome, Meckel syndrome AR 17 8
TMEM38B Osteogenesis imperfecta, type XIV AR 2 7
TMEM67 Nephronophthisis, COACH syndrome, Joubert syndrome, Meckel syndrome AR 87 170
TNFRSF11A Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 8 24
TNFRSF11B Paget disease of bone, juvenile AR 8 18
TNFSF11 Osteopetrosis, autosomal recessive 2 AR 3 5
TONSL Spondyloepimetaphyseal dysplasia AR 4
TP63 Rapp-Hodgkin syndrome, Orofacial cleft, ADULT syndrome, Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome, Ankyloblepharon-ectodermal defects-cleft lip/palate, Split-hand/foot malformation, Limb-mammary syndrome AD 59 122
TRAF3IP1 Senior-Loken syndrome 9 AR 11 15
TRAPPC2* Spondyloepiphyseal dysplasia tarda XL 12 55
TREM2 Nasu-Hakola disease, Early-onset dementia without bone cysts, Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy AR 14 48
TRIP11* Achondrogenesis, type IA AR 11 17
TRPS1 Trichorhinophalangeal syndrome type 1, Trichorhinophalangeal syndrome type 3 AD 66 140
TRPV4 Metatropic dysplasia, Spondyloepiphyseal dysplasia Maroteaux type, Parastremmatic dwarfism, Hereditary motor and sensory neuropathy, Spondylometaphyseal dysplasia Kozlowski type, Spinal muscular atrophy, Charcot-Marie-Tooth disease, Brachyolmia (autosomal dominant type), Familial Digital arthropathy with brachydactyly AD 61 78
TRPV6 Hyperparathyroidism AR 9
TTC21B Short-rib thoracic dysplasia, Nephronophthisis, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 23 63
TWIST1 Saethre-Chotzen syndrome, Robinow-Sorauf syndrome, Craniosynostosis AD 28 205
TYROBP Nasu-Hakola disease, Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy AR 8 14
UFSP2 Hip dysplasia, Beukes type AD/AR 3 3
VDR Vitamin D-dependent rickets AD/AR 17 66
VIPAS39 Arthrogryposis, renal dysfunction, and cholestasis 2 AR 8 13
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 33 43
WDR34 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 18 21
WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 AR 28 31
WDR60 Short-rib thoracic dysplasia 8 with or without polydactyly AR 12 13
WISP3 Arthropathy, progressive pseudorheumatoid, of childhood, Spondyloepiphyseal dysplasia tarda with progressive arthropathy AR 16 69
WNT1 Osteoprosis, autosomal dominant, Osteogenesis imperfecta, type XV AD/AR 9 40
WNT10B Tooth agenesis, selective, 8, Split-hand/foot malformation 6 AR 7 19
WNT5A Robinow syndrome AD 7 11
WNT7A Ulna and fibula, absence of, with severe limb deficiency (Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome), Fuhrmann syndrome AR 6 11
XRCC4 Short stature, microcephaly, and endocrine dysfunction AR 9 10
XYLT1 Desbuquois dysplasia 2 AR 11 19
XYLT2 Spondyloocular syndrome AR 2 10
ZMPSTE24 Restrictive dermopathy, lethal, Mandibuloacral dysplasia with B lipodystrophy AD/AR 13 33
ZSWIM6 Acromelic frontonasal dysostosis AD 4 2
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Skeletal Dysplasias and Disorders Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number Comment Reference
AIFM1 ChrX:129274636 c.697-44T>G NM_004208.3
AIFM1 ChrX:129299753 c.-123G>C NM_004208.3 rs724160014
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
ANKH Chr5:14871567 c.-11C>T NM_054027.4
BMP1 Chr8:22058957 c.*241T>C NM_001199.3 rs786205217
BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2
C21ORF2 Chr21:45750232 c.1000-23A>T NM_001271441.1
CANT1 Chr17:77005745 c.-342+1G>A NM_138793.3
CASR Chr3:121994640 c.1378-19A>C NM_001178065.1
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CEP152 Chr15:49059406 c.2148-17G>A NM_001194998.1 rs751691427
CEP290 Chr12:88462434 c.6012-12T>A NM_025114.3 rs752197734
CEP290 Chr12:88494960 c.2991+1655A>G NM_025114.3 rs281865192
CEP290 Chr12:88508350 c.1910-11T>G NM_025114.3
CEP290 Chr12:88534822 c.103-18_103-13delGCTTTT NM_025114.3
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
COL11A1 Chr1:103386637 c.3744+437T>G NM_080629.2
COL11A1 Chr1:103488576 c.1027-24A>G NM_080629.2
COL11A1 Chr1:103491958 c.781-450T>G NM_080629.2 rs587782990
COL1A1 Chr17:48266910 c.2668-11T>G NM_000088.3 rs786205505
COL1A1 Chr17:48267594 c.2451+94G>T NM_000088.3
COL1A1 Chr17:48267611 c.2451+77C>T NM_000088.3 rs72651665
COL1A1 Chr17:48268147 c.2343+31T>A NM_000088.3
COL1A1 Chr17:48272201 c.1354-12G>A NM_000088.3 rs72648337
COL1A1 Chr17:48273368 c.1003-43_1003-32delTGCCATCTCTTC NM_000088.3 rs72645359
COL1A1 Chr17:48273574 c.958-18_958-15delTTCC NM_000088.3 rs72645351
COL1A1 Chr17:48273742 c.904-14G>A NM_000088.3
COL1A1 Chr17:48273743 c.904-15T>A NM_000088.3
COL1A2 Chr7:94025130 c.70+717A>G NM_000089.3 rs72656354
COL1A2 Chr7:94030856 c.226-22_226-11delTTTTTTTTTTTT NM_000089.3
COL2A1 Chr12:48379984 c.1527+135G>A NM_001844.4
CREBBP Chr16:3788684 c.4281-11C>G NM_004380.2 rs587783493
CRTAP Chr3:33160815 c.472-1021C>G NM_006371.4 rs72659360
CSF1R Chr5:149440654 c.1859-119G>A NM_005211.3
CTSK Chr1:150778521 c.244-29A>G NM_000396.3
CUL7 Chr6:43010511 c.3897+29G>A NM_001168370.1
DONSON Chr21:34955994 c.786-22A>G NM_017613.3 rs1135401960
DYNC2H1 Chr11:103019205 c.2819-14A>G NM_001080463.1 rs781091611
DYNC2H1 Chr11:103055609 c.6478-16G>A NM_001080463.1 rs376892534
DYNC2LI1 Chr2:44027968 c.658-9delT NM_001193464.1 rs752971070
EFNB1 ChrX:68049209 c.-411C>G NM_004429.4
EFNB1 ChrX:68049525 c.-95T>C/G NM_004429.4
EFNB1 ChrX:68049525 c.-95T>C NM_004429.4
EFNB1 ChrX:68049525 c.-95T>G NM_004429.4
EP300 Chr22:41537040 c.1879-12A>G NM_001429.3
ESCO2 Chr8:27650167 c.1354-18G>A NM_001017420.2 rs80359865
EVC Chr4:5749725 c.940-150T>G NM_153717.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
FBN2 Chr5:127670560 c.3974-24A>C NM_001999.3
FBN2 Chr5:127670562 c.3974-26T>G NM_001999.3
FBN2 Chr5:127671284 c.3725-15A>G NM_001999.3
FGFR2 Chr10:123099960 c.*139411C>T .
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
GALNS Chr16:88898676 c.899-167A>G NM_000512.4
GALNS Chr16:88908390 c.245-11C>G NM_000512.4
GNAS Chr20:57478716 c.2242-11A>G NM_080425.2
GNPTAB Chr12:102159106 c.1613-25delA NM_024312.4 rs777271928
GNPTG Chr16:1412562 c.610-16_609+28del NM_032520.4 rs193302853
HSPG2 Chr1:22211006 c.1654+15G>A NM_005529.5
HSPG2 Chr1:22215993 c.574+481C>T NM_005529.5
IDS ChrX:148564764 c.1181-15C>A NM_000202.5
IDS ChrX:148568762 c.*57A>G NM_006123.4
IDS ChrX:148578704 c.709-657G>A NM_000202.5
IFITM5 Chr11:299504 c.-14C>T NM_001025295.2 rs587776916 Explain almost all cases of OI type V PMID 23240094
IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3
IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
LMX1B Chr9:129377616 c.140-37_140-21delGGCGCTGACGGCCGGGC NM_001174146.1
NBAS Chr2:15567431 c.2423+404G>C NM_015909.3
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NIPBL Chr5:36877039 c.-321_-320delCCinsA NM_133433.3 rs724159980
NIPBL Chr5:36877266 c.-94C>T NM_133433.3
NIPBL Chr5:36953718 c.-79-2A>G NM_133433.3
NIPBL Chr5:37022138 c.5329-15A>G NM_133433.3 rs587783968
NIPBL Chr5:37026318 c.5710-13_5710-12delCTinsAA NM_133433.3
NSDHL ChrX:152037789 c.*129C>T NM_015922.2 rs145978994
OFD1 ChrX:13768358 c.935+706A>G NM_003611.2 rs730880283
OFD1 ChrX:13773245 c.1130-22_1130-19delAATT NM_003611.2 rs312262865
OFD1 ChrX:13773249 c.1130-20_1130-16delTTGGT NM_003611.2
PAX3 Chr2:223085913 c.958+28A>T NM_181459.3
PEX7 Chr6:137143759 c.-45C>T NM_000288.3 rs267608252
PHEX ChrX:22076478 c.349+11149A>T NM_000444.4
PHEX ChrX:22113485 c.849+1268G>T NM_000444.4
PHEX ChrX:22237137 c.1701-16T>A NM_000444.4
PHEX ChrX:22237393 c.1768+177_1768+180dupGTAA NM_000444.4
PHEX ChrX:22266301 c.*231A>G NM_000444.4
PLS3 ChrX:114856534 c.74-24T>A NM_005032.5
POLR3A Chr10:79737218 c.*18C>T NM_007055.3
POLR3A Chr10:79743781 c.3337-11T>C NM_007055.3
POLR3A Chr10:79769273 c.1909+22G>A NM_007055.3 rs191875469
POLR3A Chr10:79769277 c.1909+18G>A NM_007055.3 rs267608677
POLR3B Chr12:106804589 c.967-15A>G NM_018082.5
POLR3B Chr12:106831447 c.1857-12A>G NM_018082.5 rs528038639
POR Chr7:75544501 c.-5+4A>G NM_000941.2
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTH1R Chr3:46939842 c.544-25_544-23delCTG NM_000316.2
PTH1R Chr3:46942604 c.1049+29C>T NM_000316.2
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RBBP8 Chr18:20581745 c.2287+53T>G NM_002894.2
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
SERPINF1 Chr17:1665408 c.-9+2dupT NM_002615.5 rs398122519
SERPINF1 Chr17:1674512 c.439+34C>T NM_002615.5
SERPINF1 Chr17:1675121 c.440-40_440-38delTCG NM_002615.5 rs775552455
SERPINF1 Chr17:1679209 c.787-617G>A NM_002615.5
SGSH Chr17:78190802 c.249+27_249+28delGG NM_000199.3
SHH Chr7:155599270 c.301-19G>A NM_000193.2
SHH Chr7:156061506 c.-456690G>A NM_000193.2
SHH Chr7:156583831 c.-979015A>G NM_000193.2 rs606231150
SHH Chr7:156583949 c.-979133C>G NM_000193.2 rs606231151
SHH Chr7:156583951 c.-979135C>T NM_000193.2
SHH Chr7:156584107 c.-979291T>G NM_000193.2
SHH Chr7:156584153 c.-979337A>G NM_000193.2
SHH Chr7:156584164 c.-979348A>G NM_000193.2
SHH Chr7:156584166 c.-979350G>C/T NM_000193.2
SHH Chr7:156584166 c.-979350G>A NM_000193.2 rs606231147
SHH Chr7:156584168 c.-979352C>T NM_000193.2 rs587779752
SHH Chr7:156584241 c.-979425T>C NM_000193.2 rs606231149
SHH Chr7:156584265 c.-979449A>T NM_000193.2 rs606231148
SHH Chr7:156584275 c.-979459T>C NM_000193.2 rs606231152
SHH Chr7:156584283 c.-979467C>A NM_000193.2
SHH Chr7:156584465 c.-979649C>G NM_000193.2 rs606231146
SHH Chr7:156584863 c.-980047C>T NM_000193.2
SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685
SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3
SHOX ChrX:591198 c.-432-3C>A NM_000451.3
SHOX ChrX:591568 c.-65C>A NM_000451.3
SLC26A2 Chr5:149340544 c.-26+2T>C NM_000112.3 rs386833492
SLC29A3 Chr10:73122778 c.*413G>A NM_018344.5
SMAD2 Chr18:45396947 c.237-12A>G NM_005901.5
SMARCB1 Chr22:24130008 c.93+559A>G NM_003073.3
SMARCB1 Chr22:24176316 c.1119-12C>G NM_003073.3
SMARCB1 Chr22:24176437 c.*70C>T NM_003073.3
SMARCB1 Chr22:24176449 c.*82C>T NM_003073.3
SOX9 Chr17:70117348 c.-185G>A NM_000346.3
STAMBP Chr2:74077998 c.1005+358A>G NM_006463.4
TBX3 Chr12:115122148 NM_016569.3
TBX5 Chr12:114704515 c.*88822C>A NM_000192.3 rs141875471
TBX6 Chr16:30097525 c.*21C>T NM_004608.3 rs758420111
TCF12 Chr15:57554272 c.1468-20T>A NM_207036.1
TCIRG1 Chr11:67806587 c.-5+1G>C/T NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>C NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>T NM_006019.3
TCIRG1 Chr11:67816893 c.1887+132T>C NM_006019.3
TCIRG1 Chr11:67816903 c.1887+142T>A NM_006019.3
TCIRG1 Chr11:67816907 c.1887+146G>A NM_006019.3
TCIRG1 Chr11:67816910 c.1887+149C>T NM_006019.3
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TMEM165 Chr4:56284334 c.792+182G>A NM_018475.4 rs793888506
TRPS1 Chr8:116427335 c.2824-23T>G NM_014112.2
TWIST1 Chr7:19157199 c.-255G>A NM_000474.3
TWIST1 Chr7:19157207 c.-263C>A NM_000474.3
WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1
WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1
WISP3 Chr6:112381431 c.103-763G>T NM_198239.1
WISP3 Chr6:112386227 c.643+27C>G NM_198239.1 rs200472841
XRCC4 Chr5:82400728 c.-10-1G>T NM_022406.2 rs869320678

Test Strengths

This panel includes a pathogenic intronic variant that is often missed by exome sequencing: *IFITM5* c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). The remainder of *IFITM5* is not covered at this time.

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: *ADAMTSL2* (NM_014694:11-19), *B3GAT3* (NM_001288722:5), *CC2D2A* (NM_020785:7), *IFT81* (NM_031473:12), *KIAA0586* (NM_001244189:6, 33), *POLR1C* (NM_001318876:9), *RPGRIP1L* (NM_015272:23), *SHOX* (NM_006883:6). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Marlborough, MA, are equivalent.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists, and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost, according to our latest follow-up reporting policy.