Comprehensive Skeletal Dysplasias and Disorders Panel

  • Is a 251 gene panel that includes assessment of non-coding variants.
  • Is ideal for patients with a clinical suspicion of disorders involving the skeletal system.

Analysis methods
  • PLUS

4 weeks

Number of genes


Test code


Panel size


CPT code *
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.


The Blueprint Genetics Comprehensive Skeletal Dysplasias and Disorders Panel (test code MA3301):

Test Specific Strength

This panel includes a pathogenic intronic variant that is often missed by exome sequencing: IFITM5 c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). The remainder of IFITM5 is not covered at this time.

ICD codes

Commonly used ICD-10 code(s) when ordering the Comprehensive Skeletal Dysplasias and Disorders Panel

ICD-10 Disease
Q89.7 Skeletal dysplasia and disorders

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Oragene DNA OG-500 kit/OGD-500 or OG-575 & OGD-575)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

This panel covers a broad spectrum of skeletal disorders including common and rare skeletal dysplasias (eg. achondroplasia, COL2A1 related dysplasias, diastrophic dysplasia, various types of spondylo-metaphyseal dysplasias), various ciliopathies with skeletal involvement (eg. short rib-polydactylies, asphyxiating thoracic dysplasia dysplasias and Ellis-van Creveld syndrome), various subtypes of osteogenesis imperfecta, campomelic dysplasia, slender bone dysplasias, dysplasias with multiple joint dislocations, chondrodysplasia punctata group of disorders, neonatal osteosclerotic dysplasias, osteopetrosis and related disorders, abnormal mineralization group of disorders (eg hypopohosphatasia), osteolysis group of disorders, disorders with disorganized development of skeletal components, overgrowth syndromes with skeletal involvement, craniosynostosis syndromes, dysostoses with predominant craniofacial involvement, dysostoses with predominant vertebral involvement, patellar dysostoses, brachydactylies, some disorders with limb hypoplasia-reduction defects, ectrodactyly with and without other manifestations, polydactyly-syndactyly-triphalangism group of disorders, and disorders with defects in joint formation and synostoses.

Genes in the Comprehensive Skeletal Dysplasias and Disorders Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ACAN# Spondyloepimetaphyseal dysplasia, aggrecan type, Spondyloepiphyseal dysplasia, Kimberley type, Osteochondritis dissecans, short stature, and early-onset osteoarthritis AD/AR 20 56
ACP5 Spondyloenchondrodysplasia with immune dysregulation AR 12 26
ACVR1 Fibrodysplasia ossificans progressiva AD 14 19
ADAMTS10 Weill-Marchesani syndrome AR 8 14
ADAMTS17 Weill-Marchesani-like syndrome AR 6 7
ADAMTSL2#* Geleophysic dysplasia 3 AR 8 28
AGPS Rhizomelic chondrodysplasia punctata type 3 AR 4 8
AIFM1 Deafness, Combined oxidative phosphorylation deficiency 6, Cowchock syndrome XL 27 31
AKT1 Proteus syndrome, Cowden syndrome AD 5 6
ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, juvenile and adult forms AD/AR 78 291
ALX3 Frontonasal dysplasia type 1 AR 8 8
ALX4 Frontonasal dysplasia type 2, Parietal foramina AD/AR 15 24
AMER1 Osteopathia striata with cranial sclerosis XL 14 40
ANKH Calcium pyrophosphate deposition disease (familial chondrocalcinosis type 2), Craniometaphyseal dysplasia autosomal dominant type AD 13 20
ANKRD11* KBG syndrome AD 142 132
ANO5 Gnathodiaphyseal dysplasia, LGMD2L and distal MMD3 muscular dystrophies AD/AR 64 121
ARHGAP31 Adams-Oliver syndrome AD 3 6
ARSB Mucopolysaccharidosis (Maroteaux-Lamy) AR 118 201
ARSE* Chondrodysplasia punctata X-linked recessive, brachytelephalangic type (CDPX1) XL 22 46
ATP6V0A2 Cutis laxa, Wrinkly skin syndrome AR 16 56
B3GALT6# Spondyloepimetaphyseal dysplasia with joint laxity, Ehlers-Danlos syndrome AR 17 27
B3GAT3#* Multiple joint dislocations, short stature, craniofacial dysmorphism, and congenital heart defects AR 6 13
B4GALT7 Ehlers-Danlos syndrome, progeroid form AR 8 9
BGN Spondyloepimetaphyseal dysplasia, X-linked, Meester-Loeys syndrome XL 8 7
BHLHA9 Syndactyly Malik-Percin type, mesoaxial synostotic, with phalangeal reduction, Split hand-foot malformation with long bone deficiency (SHFLD3), Gollop-Wolfgang AR 4 43
BMP1 Osteogenesis imperfecta AR 7 21
BMP2 Brachydactyly type A2 AD 5 28
BMPER Diaphanospondylodysostosis AR 6 19
BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH) AD/AR 12 23
CA2 Osteopetrosis, with renal tubular acidosis AR 9 31
CANT1 Desbuquois dysplasia AR 20 28
CASR Hypocalcemia, Neonatal hyperparathyroidism, Familial Hypocalciuric hypercalcemia with transient Neonatal hyperparathyroidism AD/AR 104 396
CDC45 Meier-Gorlin syndrome 7 AR 10 19
CDC6 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 2 2
CDKN1C Beckwith-Wiedemann syndrome, IMAGE syndrome AD 35 81
CDT1 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 6 12
CHST14 Ehlers-Danlos syndrome, musculocontractural AR 15 21
CHST3 Spondyloepiphyseal dysplasia with congenital joint dislocations (recessive Larsen syndrome) AR 18 37
CHSY1 Temtamy preaxial brachydactyly syndrome AR 6 16
CKAP2L Filippi syndrome AR 7 7
CLCN5 Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease XL 48 272
CLCN7 Osteopetrosis AD/AR 15 98
COL10A1 Metaphyseal chondrodysplasia, Schmid AD 21 53
COL11A1 Marshall syndrome, Fibrochondrogenesis, Stickler syndrome type 2 AD/AR 34 94
COL11A2 Weissenbacher-Zweymuller syndrome, Deafness, Otospondylomegaepiphyseal dysplasia, Fibrochondrogenesis, Stickler syndrome type 3 (non-ocular) AD/AR 29 57
COL1A1 Ehlers-Danlos syndrome, Caffey disease, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD 352 962
COL1A2 Ehlers-Danlos syndrome, cardiac valvular form, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AD/AR 186 509
COL27A1 Steel syndrome AR 7 7
COL2A1 Avascular necrosis of femoral head, Rhegmatogenous retinal detachment, Epiphyseal dysplasia, with myopia and deafness, Czech dysplasia, Achondrogenesis type 2, Platyspondylic dysplasia Torrance type, Hypochondrogenesis, Spondyloepiphyseal dysplasia congenital (SEDC), Spondyloepimetaphyseal dysplasia (SEMD) Strudwick type, Kniest dysplasia, Spondyloperipheral dysplasia, Mild SED with premature onset arthrosis, SED with metatarsal shortening, Stickler syndrome type 1 AD 180 561
COL9A1 Stickler syndrome recessive type, Multiple epiphyseal dysplasia type 6 (EDM6) AR 9 6
COL9A2 Stickler syndrome, Multiple epiphyseal dysplasia type 2 (EDM2) AD/AR 7 12
COL9A3 Multiple epihyseal dysplasia type 3 (EDM3), Stickler syndrome recessive type AD/AR 10 14
COMP Pseudoachondroplasia, Multiple ephiphyseal dysplasia AD 43 186
CREBBP Rubinstein-Taybi syndrome AD 175 362
CRLF1 Crisponi syndrome, Cold-induced sweating syndrome, type 1 AR 21 37
CRTAP Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 12 30
CSPP1 Jeune asphyxiating thoracic dystrophy, Joubert syndrome AR 32 27
CTSK Pycnodysostosis AR 35 58
CUL7 3-M syndrome, Yakut short stature syndrome AR 26 83
CYP27B1 Vitamin D-dependent rickets AR 23 73
DDR2 Spondylometaepiphyseal dysplasia, short limb-hand type AR 11 9
DHCR24 Desmosterolosis AR 6 9
DLL3 Spondylocostal dysostosis AR 12 26
DLL4 Adams-Oliver syndrome AD 13 14
DLX3 Amelogenesis imperfecta, Trichodontoosseous syndrome AD 5 11
DMP1 Hypophosphatemic rickets AR 5 10
DOCK6 Adams-Oliver syndrome AR 21 21
DVL1 Robinow syndrome AD 17 19
DYM Dyggve-Melchior-Clausen dysplasia, Smith-McCort dysplasia AR 22 34
DYNC2H1 Short -rib thoracic dysplasia with or without polydactyly type 1, Short -rib thoracic dysplasia with or without polydactyly type 3, Asphyxiating thoracic dysplasia (ATD; Jeune), SRPS type 2 (Majewski) AR/Digenic 148 205
EBP Chondrodysplasia punctata, Male EBP disorder with neurologic defects (MEND) XL 43 90
EFNB1 Craniofrontonasal dysplasia XL 28 116
EFTUD2 Mandibulofacial dysostosis with microcephaly, Esophageal atresia, syndromic AD 45 99
EIF2AK3 SED, Wolcott-Rallison type AR 9 80
ENAM Amelogenesis imperfecta AD/AR 8 18
ENPP1 Arterial calcification, Hypophosphatemic rickets AD/AR 22 72
EOGT Adams-Oliver syndrome AR 8 5
EP300 Rubinstein-Taybi syndrome AD 63 101
ESCO2 SC phocomelia syndrome, Roberts syndrome AR 30 31
EVC Weyers acrofacial dysostosis, Ellis-van Creveld syndrome AD/AR 58 83
EVC2 Ellis-van Creveld syndrome, Weyers acrodental dysostosis AD/AR 78 75
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
EXT2 Multiple cartilagenious exostoses 2 AD 45 250
EXTL3 Immunoskeletal dysplasia with neurodevelopmental abnormalities (ISDNA) AR 4 8
EZH2 Weaver syndrome AD 29 41
FAM111A Kenny-Caffey syndrome, type 2 AD 5 9
FAM20A Amelogenesis imperfecta (Enamel-renal syndrome) AR 19 41
FAM20C Hypophosphatemia, hyperphosphaturia, dental anomalies, intracerebral calcifications and osteosclerosis (Raine syndrome) AR 13 25
FAM83H Amelogenesis imperfecta AD 14 32
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 3 AD 1465 2679
FBN2 Congenital contractural arachnodactyly (Beals syndrome) AD 50 97
FGF23 Tumoral calcinosis, hyperphosphatemic, Hypophosphatemic rickets AD/AR 10 17
FGFR1 Pfeiffer syndrome, Trigonocephaly, Hypogonadotropic hypogonadism, Osteoglophonic Dwarfism - Craniostenosis, Hartsfield syndrome AD/Digenic/Multigenic 72 257
FGFR2 Apert syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome, Lacrimoauriculodentodigital syndrome, Beare-Stevenson cutis gyrata syndrome, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Craniofacial-skeletal-dermatological dysplasia, Crouzon syndrome, Bent bone dysplasia AD 100 154
FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN AD/AR 54 77
FKBP10 Bruck syndrome 1, Osteogenesis imperfecta, type XI AR 20 44
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects XL 133 257
FLNB Larsen syndrome (dominant), Atelosteogenesis type 1, Atelosteogenesis type 3, Spondylo-carpal-tarsal dyspasia AD/AR 43 121
GALNT3 Tumoral calcinosis, hyperphosphatemic AR 17 35
GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia AD/AR 23 53
GJA1* Oculodentodigital dysplasia mild type, Oculodentodigital dysplasia severe type, Syndactyly type 3 AD/AR 31 107
GLI3 Acrocallosal syndrome, Pallister-Hall syndrome, Grieg cephalopolysndactyly syndrome, Postaxial polydactyly type A, Preaxial polydactyly type 3, Preaxial polydactyly type 4 AD 70 235
GNAS McCune-Albright syndrome, Progressive osseous heteroplasia, Pseudohypoparathyroidism, Albright hereditary osteodystrophy AD 64 274
GNPAT Rhizomelic chondrodysplasia punctata, rhizomelic AR 8 14
GPC6 Omodysplasia 1 AR 13 9
HDAC8 Cornelia de Lange syndrome XL 41 50
HOXA13# Hand-foot-uterus syndrome, Hand-foot-genital syndrome, Guttmacher syndrome AD 8 27
HOXD13 Brachydactyly-syndactyly syndrome, Synopolydactyly, Syndactyly, Synopolydactyly with clefting, Brachydactyly type D AD/AR 18 41
HSPG2 Schwartz-Jampel syndrome, Dyssegmental dysplasia Silverman-Handmaker type, Dyssegmental dysplasia Rolland-Desbuquis type AD/AR 16 60
IDS* Mucopolysaccharidosis XL 85 637
IDUA Mucopolysaccharidosis AR 105 282
IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2 AR 13 23
IFT140 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 38 63
IFT172 Retinitis pigmentosa, Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 22 25
IFT43 Cranioectodermal dysplasia 3 AR 4 7
IFT80 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 11 11
IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly type Lueken AD/AR 12 32
IMPAD1 Chondrodysplasia with joint dislocations, GPAPP type AR 5 5
INPPL1 Opsismodysplasia AR 16 32
KAT6B Ohdo syndrome, SBBYS variant, Genitopatellar syndrome AD 47 73
KIF22 Spondyloepimetaphyseal dysplasia with joint laxity, type 2 AD 4 4
KIF7 Acrocallosal syndrome, Hydrolethalus syndrome, Al-Gazali-Bakalinova syndrome, Joubert syndrome AR/Digenic 24 44
KMT2A Wiedemann-Steiner syndrome AD 117 114
LBR Pelger-Huet anomaly, Reynolds syndrome, Greenberg/HEM skeletal dysplasia, Hydrops-ectopic calcification-moth-eaten skeletal dysplasia AD/AR 22 24
LEMD3 Buschke-Ollendorff syndrome, Osteopoikilosis AD 13 32
LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 syndrome AR 12 32
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
LMX1B Nail-patella syndrome AD 26 194
LONP1 Cerebral, Ocular, Dental, Auricular, and Skeletal anomalies (CODAS) syndrome AR 9 18
LRP4 Cenani-Lenz syndactyly syndrome, Sclerosteosis, Myasthenic syndrome, congenital AD/AR 14 28
LRP5* Van Buchem disease, Osteoporosis-pseudoglioma syndrome, Hyperostosis, endosteal, Osteosclerosis, Exudative vitreoretinopathy, Osteopetrosis late-onset form type 1, LRP5 primary osteoporosis AD/AR/Digenic 57 196
LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital AR 21 27
LTBP3 Dental anomalies and short stature, Geleophysic dysplasia 3 AD/AR 15 11
MAFB Multicentric carpotarsal osteolysis AD 13 23
MATN3 Spondyloepimetaphyseal dysplasia Matrilin type, Multiple epiphyseal dysplasia type 5 (EDM5) AD/AR 8 25
MESP2 Spondylocostal dysostosis 2, autosomal recessive AR 18 6
MGP Keutel syndrome AR 5 8
MMP13 Metaphyseal anadysplasia 1, Metaphyseal dysplasia, Spahr type, Spondyloepimetaphyseal dysplasia, Missouri type AD/AR 7 7
MMP2 Torg-Winchester syndrome, Multicentric osteolysis, nodulosis, and arthropathy AR 8 22
MMP9 Metaphyseal anadysplasia AR 1 7
MSX2* Parietal foramina, Parietal foramina with cleidocranial dysplasia, Craniosynostosis Boston type AD 9 25
MYCN Feingold syndrome AD 27 41
MYO18B Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism AR 2 4
NANS Spondyloepimetaphyseal dysplasiam Genevieve type AR 8 12
NEK1 Short -rib thoracic dysplasia with or without polydactyly, SRPS type 2 (Majewski) AR/Digenic 22 23
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan syndrome AD 1157 2901
NFIX Marshall-Smithsyndrome AD 49 78
NIPBL Cornelia de Lange syndrome AD 311 425
NKX3-2 Spondylo-megaepiphyseal-metaphyseal dysplasia AR 4 4
NOG Tarsal-carpal coalition syndrome, Multiple synostosis syndrome, Stapes ankylosis with broad thumb and toes (Teunissen-Cremers syndrome), Symphalangism, proximal, Brachydactyly type B2 AD 20 63
NOTCH2* Alagille syndrome, Hajdu-Cheney syndrome AD 37 70
NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities AD/AR 32 75
NSD1 Sotos syndrome, Weaver syndrome, Beckwith-Wiedemann syndrome AD 329 517
NSDHL Congenital hemidysplasia with ichthyosiform erythroderma and limb defects (CHILD syndrome), CK syndrome XL 15 28
OBSL1 3-M syndrome AR 13 33
ORC1 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 9 10
ORC4 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 24 6
ORC6 Meier-Gorlin syndrome (Ear-patella-short stature syndrome) AR 7 6
OSTM1 Osteopetrosis, autosomal recessive 5 AR 5 9
P3H1 Osteogenesis imperfecta AR 18 63
PAPSS2 Brachyolmia 4 with mild epiphyseal and metaphyseal changes, SEMD PAPPS2 type AR 13 20
PCNT Microcephalic osteodysplastic primordial dwarfism AR 49 88
PCYT1A Spondylometaphyseal dysplasia with cone-rod dystrophy AR 12 20
PDE4D Acrodysostosis 2, with or without hormone resistance AD 15 38
PEX7 Refsum disease, Rhizomelic CDP type 1 AR 44 53
PGM3 Immunodeficiency 23 AR 14 15
PHEX Hypophosphatemic rickets XL 263 437
PIK3CA* Cowden syndrome, CLOVES AD 85 56
PLOD2 Bruck syndrome, Osteogenesis imperfecta type 3 AR 8 23
PLS3 Osteoporosis and osteoporotic fractures XL 1 17
POLR1C# Treacher Collins syndrome AR 17 21
POLR1D Treacher Collins syndrome AD/AR 9 26
POR Disordered steroidogenesis due to cytochrome p450 oxidoreductase deficiency, Antley-Bixler syndrome AR 14 70
PPIB Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 AR 8 13
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
PTDSS1 Lenz-Majewski hyperostotic dwarfism AD 5 7
PTH1R Metaphyseal chondrodysplasia Jansen type, Failure of tooth eruption, Eiken dysplasia, Blomstrand dysplasia AD/AR 13 43
PTHLH Brachydactyly, type E2 AD 5 18
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
PYCR1 Cutis laxa AR type 2B AR 19 38
RAB33B Dyggve-Melchior-Clausen syndrome, Smith-McCort dysplasia 2 AR 6 7
RAD21* Cornelia de Lange syndrome 4 AD 14 11
RBPJ* Adams-Oliver syndrome AD 7 6
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund-Thomson syndrome AR 82 114
RMRP Cartilage-hair hypoplasia, Metaphyseal dysplasia without hypotrichosis, Anauxetic dysplasia AR 87 123
RNU4ATAC Roifman syndrome, Microcephalic osteodysplastic primordial dwarfism type 1, Microcephalic osteodysplastic primordial dwarfism type 3 AR 15 24
ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40
RUNX2 Cleidocranial dysplasia, Metaphyseal dysplasia with maxillary hypoplasia AD 21 216
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe spondylometaphyseal dysplasia AD/AR 19 90
SERPINF1 Osteogenesis imperfecta, type VI AR 9 41
SERPINH1 Osteogenesis imperfecta type 3 AR 3 6
SETBP1 Mental retardation, autosomal dominant 29, Schinzel-Giedion midface retraction syndrome AD 23 46
SF3B4 Acrofacial dysostosis 1, Nager AD 27 38
SH3BP2 Cherubism AD 9 16
SH3PXD2B Frank-ter Haar syndrome AR 8 20
SHOX#* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Short stature XL/PAR 25 431
SKI Shprintzen-Goldberg syndrome AD 20 23
SLC26A2 Diastrophic dysplasia, Atelosteogenesis type 2, De la Chapelle dysplasia, Recessive Multiple Epiphyseal dysplasia, Achondrogenesis type 1B AR 73 54
SLC29A3 Histiocytosis-lymphadenopathy plus syndrome, Dysosteosclerosis AR 17 25
SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38
SLC35D1 Schneckenbecken dysplasia AR 7 7
SLC39A13 Spondylodysplastic Ehlers-Danlos syndrome AR 2 9
SLCO2A1 Hypertrophic osteoarthropathy AD/AR 13 72
SMAD3 Aneurysms-osteoarthritis syndrome, Loeys-Dietz syndrome AD 48 82
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SMARCAL1 Schimke immunoosseous dysplasia AR 20 88
SMC1A Cornelia de Lange syndrome XL 73 87
SMC3 Cornelia de Lange syndrome AD 25 21
SNX10 Osteopetrosis, autosomal recessive 8 AR 3 13
SOST Craniodiaphyseal dysplasia, autosomal dominant, Sclerosteosis 1, van Buchem disease AD/AR 6 14
SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia (Cooks syndrome) AD 47 144
SP7 Osteogenesis imperfecta, type XII AR 2 3
STAMBP Microcephaly-capillary malformation syndrome AR 15 19
TBX15 Cousin syndrome AR 2 4
TBX3 Ulnar-Mammary syndrome AD 6 20
TBX4 Small patella syndrome AD 8 58
TBX6 Spondylocostal dysostosis 5 AD/AR 9 34
TCF12 Craniosynostosis AD 23 56
TCIRG1 Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 48 130
TCOF1 Treacher Collins syndrome AD 50 330
TCTN3 Orofaciodigital syndrome (Mohr-Majewski syndrome), Joubert syndrome AR 9 12
TGFB1 Diaphyseal dysplasia Camurati-Engelmann AD 15 23
TGFB2 Loeys-Dietz syndrome AD 36 38
TGFB3 Loeys-Dietz syndrome (Reinhoff syndrome), Arrhythmogenic right ventricular dysplasia AD 19 26
TGFBR1 Loeys-Dietz syndrome AD 40 69
TGFBR2 Loeys-Dietz syndrome AD 58 139
TMEM38B Osteogenesis imperfecta, type XIV AR 2 7
TNFRSF11A Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe neonatal or infantile forms (OPTB1) AD/AR 8 24
TNFRSF11B Paget disease of bone, juvenile AR 8 18
TNFSF11 Osteopetrosis, autosomal recessive 2 AR 3 5
TP63 Rapp-Hodgkin syndrome, Orofacial cleft, ADULT syndrome, Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome, Ankyloblepharon-ectodermal defects-cleft lip/palate, Split-hand/foot malformation, Limb-mammary syndrome AD 59 122
TRAPPC2* Spondyloepiphyseal dysplasia tarda XL 12 55
TRIP11* Achondrogenesis, type IA AR 11 17
TRPS1 Trichorhinophalangeal syndrome type 1, Trichorhinophalangeal syndrome type 3 AD 66 140
TRPV4 Metatropic dysplasia, Spondyloepiphyseal dysplasia Maroteaux type, Parastremmatic dwarfism, Hereditary motor and sensory neuropathy, Spondylometaphyseal dysplasia Kozlowski type, Spinal muscular atrophy, Charcot-Marie-Tooth disease, Brachyolmia (autosomal dominant type), Familial Digital arthropathy with brachydactyly AD 61 78
TTC21B Short-rib thoracic dysplasia, Nephronophthisis, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 23 63
TWIST1 Saethre-Chotzen syndrome, Robinow-Sorauf syndrome, Craniosynostosis AD 28 205
TYROBP Nasu-Hakola disease, Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy AR 8 14
VDR Vitamin D-dependent rickets AD/AR 17 66
VIPAS39 Arthrogryposis, renal dysfunction, and cholestasis 2 AR 8 13
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 33 43
WDR34 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 18 21
WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 AR 28 31
WDR60 Short-rib thoracic dysplasia 8 with or without polydactyly AR 12 13
WISP3 Arthropathy, progressive pseudorheumatoid, of childhood, Spondyloepiphyseal dysplasia tarda with progressive arthropathy AR 16 69
WNT1 Osteoprosis, autosomal dominant, Osteogenesis imperfecta, type XV AD/AR 9 40
WNT5A Robinow syndrome AD 7 11
XYLT1 Desbuquois dysplasia 2 AR 11 19

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Skeletal Dysplasias and Disorders Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
AIFM1 ChrX:129274636 c.697-44T>G NM_004208.3
AIFM1 ChrX:129299753 c.-123G>C NM_004208.3 rs724160014
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
ANKH Chr5:14871567 c.-11C>T NM_054027.4
BMP1 Chr8:22058957 c.*241T>C NM_001199.3 rs786205217
BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2
CANT1 Chr17:77005745 c.-342+1G>A NM_138793.3
CASR Chr3:121994640 c.1378-19A>C NM_001178065.1
CDKN1C Chr11:2905209 c.*5+20G>T NM_000076.2 rs760540648
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
COL11A1 Chr1:103386637 c.3744+437T>G NM_080629.2
COL11A1 Chr1:103488576 c.1027-24A>G NM_080629.2
COL11A1 Chr1:103491958 c.781-450T>G NM_080629.2 rs587782990
COL1A1 Chr17:48266910 c.2668-11T>G NM_000088.3 rs786205505
COL1A1 Chr17:48267594 c.2451+94G>T NM_000088.3
COL1A1 Chr17:48267611 c.2451+77C>T NM_000088.3 rs72651665
COL1A1 Chr17:48268147 c.2343+31T>A NM_000088.3
COL1A1 Chr17:48272201 c.1354-12G>A NM_000088.3 rs72648337
COL1A1 Chr17:48273368 c.1003-43_1003-32delTGCCATCTCTTC NM_000088.3 rs72645359
COL1A1 Chr17:48273574 c.958-18_958-15delTTCC NM_000088.3 rs72645351
COL1A1 Chr17:48273742 c.904-14G>A NM_000088.3
COL1A1 Chr17:48273743 c.904-15T>A NM_000088.3
COL1A2 Chr7:94025130 c.70+717A>G NM_000089.3 rs72656354
COL1A2 Chr7:94030856 c.226-22_226-11delTTTTTTTTTTTT NM_000089.3
COL2A1 Chr12:48379984 c.1527+135G>A NM_001844.4
CREBBP Chr16:3788684 c.4281-11C>G NM_004380.2 rs587783493
CRTAP Chr3:33160815 c.472-1021C>G NM_006371.4 rs72659360
CTSK Chr1:150778521 c.244-29A>G NM_000396.3
CUL7 Chr6:43010511 c.3897+29G>A NM_001168370.1
DYNC2H1 Chr11:103019205 c.2819-14A>G NM_001080463.1 rs781091611
DYNC2H1 Chr11:103055609 c.6478-16G>A NM_001080463.1 rs376892534
EFNB1 ChrX:68049209 c.-411C>G NM_004429.4
EFNB1 ChrX:68049525 c.-95T>C/G NM_004429.4
EFNB1 ChrX:68049525 c.-95T>C NM_004429.4
EFNB1 ChrX:68049525 c.-95T>G NM_004429.4
EP300 Chr22:41537040 c.1879-12A>G NM_001429.3
ESCO2 Chr8:27650167 c.1354-18G>A NM_001017420.2 rs80359865
EVC Chr4:5749725 c.940-150T>G NM_153717.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
FBN2 Chr5:127670560 c.3974-24A>C NM_001999.3
FBN2 Chr5:127670562 c.3974-26T>G NM_001999.3
FBN2 Chr5:127671284 c.3725-15A>G NM_001999.3
FGFR2 Chr10:123099960 c.*139411C>T .
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
GNAS Chr20:57478716 c.2242-11A>G NM_080425.2
HSPG2 Chr1:22211006 c.1654+15G>A NM_005529.5
HSPG2 Chr1:22215993 c.574+481C>T NM_005529.5
IDS ChrX:148564764 c.1181-15C>A NM_000202.5
IDS ChrX:148568762 c.*57A>G NM_006123.4
IDS ChrX:148578704 c.709-657G>A NM_000202.5
IFITM5 Chr11:299504 c.-14C>T NM_001025295.2 rs587776916 Explain almost all cases of OI type V PMID 23240094
IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3
IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
LMX1B Chr9:129377616 c.140-37_140-21delGGCGCTGACGGCCGGGC NM_001174146.1
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
NIPBL Chr5:36877039 c.-321_-320delCCinsA NM_133433.3 rs724159980
NIPBL Chr5:36877266 c.-94C>T NM_133433.3
NIPBL Chr5:36953718 c.-79-2A>G NM_133433.3
NIPBL Chr5:37022138 c.5329-15A>G NM_133433.3 rs587783968
NIPBL Chr5:37026318 c.5710-13_5710-12delCTinsAA NM_133433.3
NSDHL ChrX:152037789 c.*129C>T NM_015922.2 rs145978994
PEX7 Chr6:137143759 c.-45C>T NM_000288.3 rs267608252
PHEX ChrX:22076478 c.349+11149A>T NM_000444.4
PHEX ChrX:22113485 c.849+1268G>T NM_000444.4
PHEX ChrX:22237137 c.1701-16T>A NM_000444.4
PHEX ChrX:22237393 c.1768+177_1768+180dupGTAA NM_000444.4
PHEX ChrX:22266301 c.*231A>G NM_000444.4
PLS3 ChrX:114856534 c.74-24T>A NM_005032.5
POR Chr7:75544501 c.-5+4A>G NM_000941.2
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
PTH1R Chr3:46939842 c.544-25_544-23delCTG NM_000316.2
PTH1R Chr3:46942604 c.1049+29C>T NM_000316.2
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RMRP Chr9:35658026 NR_003051.3 rs781730798
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658026 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658027 NR_003051.3 rs727502775
RMRP Chr9:35658027 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658028 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658029 NR_003051.3
RMRP Chr9:35658032 NR_003051.3
SERPINF1 Chr17:1665408 c.-9+2dupT NM_002615.5 rs398122519
SERPINF1 Chr17:1674512 c.439+34C>T NM_002615.5
SERPINF1 Chr17:1675121 c.440-40_440-38delTCG NM_002615.5 rs775552455
SERPINF1 Chr17:1679209 c.787-617G>A NM_002615.5
SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685
SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3
SHOX ChrX:591198 c.-432-3C>A NM_000451.3
SHOX ChrX:591568 c.-65C>A NM_000451.3
SLC26A2 Chr5:149340544 c.-26+2T>C NM_000112.3 rs386833492
SLC29A3 Chr10:73122778 c.*413G>A NM_018344.5
SOX9 Chr17:70117348 c.-185G>A NM_000346.3
STAMBP Chr2:74077998 c.1005+358A>G NM_006463.4
TBX3 Chr12:115122148 NM_016569.3
TBX6 Chr16:30097525 c.*21C>T NM_004608.3 rs758420111
TCF12 Chr15:57554272 c.1468-20T>A NM_207036.1
TCIRG1 Chr11:67806587 c.-5+1G>C/T NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>C NM_006019.3
TCIRG1 Chr11:67806587 c.-5+1G>T NM_006019.3
TCIRG1 Chr11:67816893 c.1887+132T>C NM_006019.3
TCIRG1 Chr11:67816903 c.1887+142T>A NM_006019.3
TCIRG1 Chr11:67816907 c.1887+146G>A NM_006019.3
TCIRG1 Chr11:67816910 c.1887+149C>T NM_006019.3
TGFB3 Chr14:76425035 c.*495C>T NM_003239.2 rs387906514
TGFB3 Chr14:76447266 c.-30G>A NM_003239.2 rs770828281
TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2
TRPS1 Chr8:116427335 c.2824-23T>G NM_014112.2
TWIST1 Chr7:19157199 c.-255G>A NM_000474.3
TWIST1 Chr7:19157207 c.-263C>A NM_000474.3
WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1
WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1
WISP3 Chr6:112381431 c.103-763G>T NM_198239.1
WISP3 Chr6:112386227 c.643+27C>G NM_198239.1 rs200472841

Test Strengths

This panel includes a pathogenic intronic variant that is often missed by exome sequencing: IFITM5 c.-14C>T (rs587776916), which accounts for almost all cases of osteogenesis imperfecta type V (PMID 23240094). The remainder of IFITM5 is not covered at this time.

The strengths of this test include:
  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ADAMTSL2 (NM_014694:11-19), B3GAT3 (NM_001288722:5), POLR1C (NM_001318876:9), SHOX (NM_006883:6). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Size range (0.1-47 Mb) 100% (25/25)
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % (TP/(TP+FN) Specificity
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
All types
Single nucleotide variants n=2084 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3%(12/13) 99.98%
Heteroplasmic (<5%) 88.7% (47/53) 99.93%
Insertions and deletions by sequence analysis n=42 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) >0.9999
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X


The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Subscribe to our newsletter