Micromelic Dysplasia Panel

Summary
  • Is a 27 gene panel that includes assessment of non-coding variants
  • Is ideal for patients with a clinical suspicion of acromesomelic dysplasia, cranioectodermal dysplasia, Robinow syndrome or Weill-Marchesani syndrome. The genes on this panel are included in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel.

Analysis methods
  • PLUS
Availability

4 weeks

Number of genes

27

Test code

MA1901

Panel size

Small

CPT codes
81479

Summary

The Blueprint Genetics Micromelic Dysplasia Panel (test code MA1901):

ICD codes

Commonly used ICD-10 code(s) when ordering the Micromelic Dysplasia Panel

ICD-10 Disease
Q87.1 Acromesomelic dysplasia
Q87.1 Cranioectodermal dysplasia
Q87.1 Robinow syndrome
Q87.1 Weill-Marchesani syndrome

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Oragene DNA OG-500 kit/OGD-500 or OG-575 & OGD-575)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

Note that we do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. Read more about our sample requirements here.

Acromesomelic dysplasia is an autosomal recessively inherited group of rare disorders characterized by severe dwarfism and limb abnormalities with normal facial appearance and intellect. Mutations in different genes cause three different types of acromesomelic dysplasia: Grebe, Hunter-Thomson and Maroteaux types. Robinow syndrome is characterized by limb shortening and abnormalities of the head, face and external genitalia. The clinical features are generally milder in the more common autosomal dominant form of Robinow syndrome than in the autosomal recessive form. In the presence of rib fusions, the recessive form of the syndrome should be considered. Cranioectodermal dysplasia is a rare developmental disorder characterized by congenital skeletal and ectodermal defects including dysmorphic features, nephronophthisis, hepatic fibrosis and ocular anomalies (mainly retinitis pigmentosa). Cranioectodermal dysplasia is a heterogenous disease belonging to the ciliopathies and is caused by mutations in the IFT122, IFT43, WDR19 and WDR35 genes. In most cases, the mode of inheritance is autosomal recessive. Weill-Marchesani syndrome is a rare condition characterized by short stature, brachydactyly, joint stiffness, and characteristic eye abnormalities including microspherophakia, ectopia of the lens, severe myopia, and glaucoma. Both autosomal recessive and autosomal dominant forms exist. Achondroplasia is characterized by rhizomelia, exaggerated lumbar lordosis, brachydactyly, and macrocephaly with frontal bossing and midface hypoplasia. The estimated incidence is at about 1/25,000 live births worldwide. Achondroplasia is due to mutations in the FGFR3 gene. Inheritance is autosomal dominant so genetic counseling is warranted. Achondroplasia has overlapping features with conditions such as multiple epiphyseal dysplasia tarda, achondrogenesis, osteopetrosis, and thanatophoric dysplasia.

Genes in the Micromelic Dysplasia Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ADAMTS10 Weill-Marchesani syndrome AR 8 14
ADAMTSL2#* Geleophysic dysplasia 3 AR 8 28
BMPR1B Acromesomelic dysplasia, Demirhan, Brachydactyly C/Symphalangism-like pheno, Brachydactyly type A2, Pulmonary arterial hypertension (PAH) AD/AR 12 23
DVL1 Robinow syndrome AD 17 19
EXT1 Multiple cartilagenious exostoses 1 AD 97 523
FBN1 MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 3 AD 1465 2679
FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN AD/AR 54 77
GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia AD/AR 23 53
GNAS McCune-Albright syndrome, Progressive osseous heteroplasia, Pseudohypoparathyroidism, Albright hereditary osteodystrophy AD 64 274
IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2 AR 13 23
IFT140 Short -rib thoracic dysplasia with or without polydactyly, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 38 63
IHH Acrocapitofemoral dysplasia, Brachydactyly, Syndactyly type Lueken AD/AR 12 32
INPPL1 Opsismodysplasia AR 16 32
LIFR Stuve-Wiedemann dysplasia, Schwartz-Jampel type 2 syndrome AR 12 32
LTBP2 Weill-Marchesani syndrome, Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma, Glaucoma, primary congenital AR 21 27
NPR2 Acromesomelic dysplasia type Maroteaux, Epiphyseal chondrodysplasia, Miura, Short stature with nonspecific skeletal abnormalities AD/AR 32 75
PRKAR1A Myxoma, intracardiac, Acrodysostosis, Pigmented nodular adrenocortical disease, Carney complex AD 75 183
ROR2 Robinow syndrome recessive type, Brachydactyly type B AD/AR 21 40
SHOX#* Leri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Short stature XL/PAR 25 431
SLC35D1 Schneckenbecken dysplasia AR 7 7
SMAD4 Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Polyposis, juvenile intestinal, Myhre dysplasia, Hereditary hemorrhagic telangiectasia AD 179 143
SOX9 Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia (Cooks syndrome) AD 47 144
TRIP11* Achondrogenesis, type IA AR 11 17
TRPS1 Trichorhinophalangeal syndrome type 1, Trichorhinophalangeal syndrome type 3 AD 66 140
WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) AR 33 43
WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 AR 28 31
WNT5A Robinow syndrome AD 7 11

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads).

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Orphanet databases.

Non-coding variants covered by Micromelic Dysplasia Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
BMPR1B Chr4:95797053 c.-113+2T>G NM_001203.2
FBN1 Chr15:48707358 c.8051+375G>T NM_000138.4
FBN1 Chr15:48720682 c.6872-14A>G NM_000138.4
FBN1 Chr15:48721629 c.6872-961A>G NM_000138.4
FBN1 Chr15:48739106 c.5672-87A>G NM_000138.4
FBN1 Chr15:48739107 c.5672-88A>G NM_000138.4
FBN1 Chr15:48764885 c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT NM_000138.4
FBN1 Chr15:48786466 c.2678-15C>A NM_000138.4
FBN1 Chr15:48802380 c.1589-14A>G NM_000138.4
FBN1 Chr15:48818478 c.863-26C>T NM_000138.4
GNAS Chr20:57478716 c.2242-11A>G NM_080425.2
IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3
IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192
PRKAR1A Chr17:66508599 c.-97G>A NM_002734.4
PRKAR1A Chr17:66508689 c.-7G>A NM_002734.4
PRKAR1A Chr17:66508690 c.-7+1G>A NM_002734.4
PRKAR1A Chr17:66521878 c.550-17T>A NM_002734.4
PRKAR1A Chr17:66523964 c.709-7_709-2delTTTTTA NM_002734.4 rs281864801
SHOX ChrX:585123 c.-645_-644insGTT NM_000451.3 rs199946685
SHOX ChrX:585124 c.-645_-644insGTT NM_000451.3
SHOX ChrX:591198 c.-432-3C>A NM_000451.3 rs1030279647
SHOX ChrX:591568 c.-65C>A NM_000451.3 rs922062046
SOX9 Chr17:70117348 c.-185G>A NM_000346.3
TRPS1 Chr8:116427335 c.2824-23T>G NM_014112.2
WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1
WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1

Test Strengths

The strengths of this test include:
  • CAP and ISO-15189 accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see below ‘Non-coding disease causing variants covered by this panel’)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: ADAMTSL2 (NM_014694:11-19), SHOX (NM_006883:6). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene's target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Mitochondrial DNA variants
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The Blueprint Genetics micromelic dysplasia panel covers classical genes associated with acromesomelic dysplasia, cranioectodermal dysplasia, Robinow syndrome and Weill-Marchesani syndrome. The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sliced from our high-quality whole exome sequencing data. Please see our sequencing and detection performance table for different types of alterations at the whole exome level (Table).

Assays have been validated for different starting materials including EDTA-blood, isolated DNA (no FFPE), saliva and dry blood spots (filter card) and all provide high-quality results. The diagnostic yield varies substantially depending on the assay used, referring healthcare professional, hospital and country. Blueprint Genetics' Plus Analysis (Seq+Del/Dup) maximizes the chance to find a molecular genetic diagnosis for your patient although Sequence Analysis or Del/Dup Analysis may be a cost-effective first line test if your patient's phenotype is suggestive of a specific mutation type.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999
Insertions, deletions and indels by sequence analysis
1-10 bps 96.9% (7,563/7,806) >99.9999
11-50 bps 99.13% (2,524/2,546) >99.9999
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
     
The performance presented above reached by WES with the following coverage metrics
     
Mean sequencing depth at exome level 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with <20X sequencing depth if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the Blueprint Genetics Variant Classification Schemes based on the ACMG guideline 2015. Minor modifications were made to increase reproducibility of the variant classification and improve the clinical validity of the report. Our experience with tens of thousands of clinical cases analyzed at our laboratory allowed us to further develop the industry standard.

The final step in the analysis is orthogonal confirmation. Sequence variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing when they do not meet our stringent NGS quality metrics for a true positive call.
Reported heterozygous and homo/hemizygous copy number variations with a size <10 and <3 target exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen and confirmed less than three times at Blueprint Genetics.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Subscribe to our newsletter