Skeletal Dysplasia with Abnormal Mineralization Panel
Is ideal for patients with a clinical suspicion of hypophosphatasia or hypophosphatemic rickets. The genes on this panel are included in the Comprehensive Growth Disorders / Skeletal Dysplasias and Disorders Panel.
- PLUS
Summary
The Blueprint Genetics Skeletal Dysplasia with Abnormal Mineralization Panel (test code MA1301):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
ICD Codes
Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
Hypophosphatasia is a rare inherited skeletal dysplasia due to loss of function mutations in the ALPL gene. It is characterized by defective mineralization of bone and/or teeth in the presence of low activity of serum and bone alkaline phosphatase. Clinical features range from stillbirth without mineralized bone at the severe end to pathologic fractures of the lower extremities in later adulthood at the mild end. At least six clinical forms are currently recognized based on age at diagnosis and severity of features. The differential diagnosis of hypophosphatasia depends on the age at which the diagnosis is considered. In utero, osteogenesis imperfecta (OI) type II and campomelic dysplasia are the most common differential diagnoses. Rare conditions such as Stuve–Wiedemann syndrome may also be involved. At birth, OI type II, campomelic dysplasia, and chondrodysplasias with bone mineralization defect are very similar diseases and are challenging to differentiate radiographically. In infancy and childhood, different OI types are the most common differential diagnosis, but rarer disorders such as cleidocranial dysostosis, Cole-Carpenter syndrome, idiopathic juvenile osteoporosis, and renal osteodystrophy should be considered. In adulthood, osteopenia/osteoporosis and more rarely osteoarthritis and pseudogout may be caused by hypophosphatasia. Serum alkaline phosphatase activity can suggest the diagnosis pending confirmation with genetic testing. Hypophosphatemic rickets (HR) is a genetic disorder which prevents sufficient reabsorption of phosphate in the proximal renal tubule, with increased phosphate excretion, resulting in rickets. Rickets is a metabolic disorder of the growing bone which occurs in children before fusion of the epiphysis and is characterized by impaired mineralization of the osteoid matrix during growth. The most common form of HR is inherited in an X-linked manner, but the remaining 20% of familial HR patients belong to the autosomal dominant HR and to the hereditary HR with calciuria types.
Genes in the Skeletal Dysplasia with Abnormal Mineralization Panel and their clinical significance
To view complete table content, scroll horizontally.
Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
---|---|---|---|---|
ALPL | Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, juvenile and adult forms | AD/AR | 78 | 291 |
ANKH | Calcium pyrophosphate deposition disease (familial chondrocalcinosis type 2), Craniometaphyseal dysplasia autosomal dominant type | AD | 13 | 20 |
B4GALT7 | Ehlers-Danlos syndrome, progeroid form | AR | 8 | 9 |
CASR | Hypocalcemia, Neonatal hyperparathyroidism, Familial Hypocalciuric hypercalcemia with transient Neonatal hyperparathyroidism | AD/AR | 104 | 396 |
CLCN5 | Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease | XL | 48 | 272 |
COL1A1 | Ehlers-Danlos syndrome, Caffey disease, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 | AD | 352 | 962 |
COL1A2 | Ehlers-Danlos syndrome, cardiac valvular form, Osteogenesis imperfecta type 1, Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 | AD/AR | 186 | 509 |
COL3A1 | Ehlers-Danlos syndrome | AD | 520 | 631 |
COL5A1 | Ehlers-Danlos syndrome | AD | 101 | 154 |
COL5A2 | Ehlers-Danlos syndrome | AD | 24 | 35 |
CRTAP | Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 | AR | 12 | 30 |
CYP27B1 | Vitamin D-dependent rickets | AR | 23 | 73 |
CYP2R1 | Vitamin D hydroxylation deficient rickets, type 1B | AR | 2 | 6 |
DMP1 | Hypophosphatemic rickets | AR | 5 | 10 |
ENPP1 | Arterial calcification, Hypophosphatemic rickets | AD/AR | 22 | 72 |
FBN1 | MASS syndrome, Marfan syndrome, Acromicric dysplasia, Geleophysic dysplasia 3 | AD | 1465 | 2679 |
FGF23 | Tumoral calcinosis, hyperphosphatemic, Hypophosphatemic rickets | AD/AR | 10 | 17 |
FKBP10 | Bruck syndrome 1, Osteogenesis imperfecta, type XI | AR | 20 | 44 |
GALNT3 | Tumoral calcinosis, hyperphosphatemic | AR | 17 | 35 |
MGP | Keutel syndrome | AR | 5 | 8 |
P3H1 | Osteogenesis imperfecta | AR | 18 | 63 |
PHEX | Hypophosphatemic rickets | XL | 263 | 437 |
PLOD2 | Bruck syndrome, Osteogenesis imperfecta type 3 | AR | 8 | 23 |
PLS3 | Osteoporosis and osteoporotic fractures | XL | 1 | 17 |
PPIB | Osteogenesis imperfecta type 2, Osteogenesis imperfecta type 3, Osteogenesis imperfecta type 4 | AR | 8 | 13 |
PTDSS1 | Lenz-Majewski hyperostotic dwarfism | AD | 5 | 7 |
SERPINF1 | Osteogenesis imperfecta, type VI | AR | 9 | 41 |
SGMS2 | Osteoporosis and osteoporotic fractures, Skeletal dysplasia and disorders | AD | ||
SLC34A3 | Hypophosphatemic rickets with hypercalciuria | AR | 22 | 38 |
SLC39A13 | Spondylodysplastic Ehlers-Danlos syndrome | AR | 2 | 9 |
SNX10 | Osteopetrosis, autosomal recessive 8 | AR | 3 | 13 |
SOX9 | Campomelic dysplasia, 46,XY sex reversal, Brachydactyly with anonychia (Cooks syndrome) | AD | 47 | 144 |
TNFRSF11A | Familial expansile osteolysis, Paget disease of bone, Osteopetrosis, severe neonatal or infantile forms (OPTB1) | AD/AR | 8 | 24 |
TNFRSF11B | Paget disease of bone, juvenile | AR | 8 | 18 |
VDR | Vitamin D-dependent rickets | AD/AR | 17 | 66 |
XYLT2 | Spondyloocular syndrome | AR | 2 | 10 |
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Skeletal Dysplasia with Abnormal Mineralization Panel
To view complete table content, scroll horizontally.
Gene | Genomic location HG19 | HGVS | RefSeq | RS-number | Comment | Reference |
---|---|---|---|---|---|---|
ALPL | Chr1:21835920 | c.-195C>T | NM_000478.4 | |||
ALPL | Chr1:21896764 | c.793-30_793-11delGGCATGTGCTGACACAGCCC | NM_000478.4 | |||
ANKH | Chr5:14871567 | c.-11C>T | NM_054027.4 | |||
CASR | Chr3:121994640 | c.1378-19A>C | NM_001178065.1 | |||
COL1A1 | Chr17:48266910 | c.2668-11T>G | NM_000088.3 | rs786205505 | ||
COL1A1 | Chr17:48267594 | c.2451+94G>T | NM_000088.3 | |||
COL1A1 | Chr17:48267611 | c.2451+77C>T | NM_000088.3 | rs72651665 | ||
COL1A1 | Chr17:48268147 | c.2343+31T>A | NM_000088.3 | |||
COL1A1 | Chr17:48272201 | c.1354-12G>A | NM_000088.3 | rs72648337 | ||
COL1A1 | Chr17:48273368 | c.1003-43_1003-32delTGCCATCTCTTC | NM_000088.3 | rs72645359 | ||
COL1A1 | Chr17:48273574 | c.958-18_958-15delTTCC | NM_000088.3 | rs72645351 | ||
COL1A1 | Chr17:48273742 | c.904-14G>A | NM_000088.3 | |||
COL1A1 | Chr17:48273743 | c.904-15T>A | NM_000088.3 | |||
COL1A2 | Chr7:94025130 | c.70+717A>G | NM_000089.3 | rs72656354 | ||
COL1A2 | Chr7:94030856 | c.226-22_226-11delTTTTTTTTTTTT | NM_000089.3 | |||
COL3A1 | Chr2:189872183 | c.3256-43T>G | NM_000090.3 | rs587779667 | ||
COL5A1 | Chr9:137645685 | c.1720-11T>A | NM_000093.4 | rs863223444 | ||
COL5A1 | Chr9:137680989 | c.2647-12A>G | NM_000093.4 | |||
COL5A1 | Chr9:137686903 | c.2701-25T>G | NM_000093.4 | rs765079080 | ||
COL5A1 | Chr9:137726806 | c.5137-11T>A | NM_000093.4 | rs183495554 | ||
COL5A2 | Chr2:189927655 | c.1924-11T>C | NM_000393.3 | |||
CRTAP | Chr3:33160815 | c.472-1021C>G | NM_006371.4 | rs72659360 | ||
FBN1 | Chr15:48707358 | c.8051+375G>T | NM_000138.4 | |||
FBN1 | Chr15:48720682 | c.6872-14A>G | NM_000138.4 | |||
FBN1 | Chr15:48721629 | c.6872-961A>G | NM_000138.4 | |||
FBN1 | Chr15:48739106 | c.5672-87A>G | NM_000138.4 | |||
FBN1 | Chr15:48739107 | c.5672-88A>G | NM_000138.4 | |||
FBN1 | Chr15:48764885 | c.4211-32_4211-13delGAAGAGTAACGTGTGTTTCT | NM_000138.4 | |||
FBN1 | Chr15:48786466 | c.2678-15C>A | NM_000138.4 | |||
FBN1 | Chr15:48802380 | c.1589-14A>G | NM_000138.4 | |||
FBN1 | Chr15:48818478 | c.863-26C>T | NM_000138.4 | |||
IFITM5 | Chr11:299504 | c.-14C>T | NM_001025295.2 | rs587776916 | Explain almost all cases of OI type V | PMID 23240094 |
PHEX | ChrX:22076478 | c.349+11149A>T | NM_000444.4 | |||
PHEX | ChrX:22113485 | c.849+1268G>T | NM_000444.4 | |||
PHEX | ChrX:22237137 | c.1701-16T>A | NM_000444.4 | |||
PHEX | ChrX:22237393 | c.1768+177_1768+180dupGTAA | NM_000444.4 | |||
PHEX | ChrX:22266301 | c.*231A>G | NM_000444.4 | |||
PLS3 | ChrX:114856534 | c.74-24T>A | NM_005032.5 | |||
SERPINF1 | Chr17:1665408 | c.-9+2dupT | NM_002615.5 | rs398122519 | ||
SERPINF1 | Chr17:1674512 | c.439+34C>T | NM_002615.5 | |||
SERPINF1 | Chr17:1675121 | c.440-40_440-38delTCG | NM_002615.5 | rs775552455 | ||
SERPINF1 | Chr17:1679209 | c.787-617G>A | NM_002615.5 | |||
SOX9 | Chr17:70117348 | c.-185G>A | NM_000346.3 |
Test Strengths
The strengths of this test include:
- CAP accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
- Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
- ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.
Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).
Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.
The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Marlborough, MA, are equivalent.
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Sensitivity % (TP/(TP+FN) | Specificity % | |
---|---|---|
Single nucleotide variants | 99.89% (99,153/99,266) | >99.9999% |
Insertions, deletions and indels by sequence analysis | ||
1-10 bps | 99.2% (7,745/7,806) | >99.9999% |
11-50 bps | 99.13% (2,524/2,546) | >99.9999% |
Copy number variants (exon level dels/dups) | ||
1 exon level deletion (heterozygous) | 100% (20/20) | NA |
1 exon level deletion (homozygous) | 100% (5/5) | NA |
1 exon level deletion (het or homo) | 100% (25/25) | NA |
2-7 exon level deletion (het or homo) | 100% (44/44) | NA |
1-9 exon level duplication (het or homo) | 75% (6/8) | NA |
Simulated CNV detection | ||
5 exons level deletion/duplication | 98.7% | 100.00% |
Microdeletion/-duplication sdrs (large CNVs, n=37)) | ||
Size range (0.1-47 Mb) | 100% (25/25) | |
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||
Mean sequencing depth | 143X | |
Nucleotides with >20x sequencing coverage (%) | 99.86% |
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
Sensitivity % | Specificity % | |
---|---|---|
ANALYTIC VALIDATION (NA samples; n=4) | ||
Single nucleotide variants | ||
Heteroplasmic (45-100%) | 100.0% (50/50) | 100.0% |
Heteroplasmic (35-45%) | 100.0% (87/87) | 100.0% |
Heteroplasmic (25-35%) | 100.0% (73/73) | 100.0% |
Heteroplasmic (15-25%) | 100.0% (77/77) | 100.0% |
Heteroplasmic (10-15%) | 100.0% (74/74) | 100.0% |
Heteroplasmic (5-10%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (<5%) | 50.0% (2/4) | 100.0% |
CLINICAL VALIDATION (n=76 samples) | ||
All types | ||
Single nucleotide variants n=2026 SNVs | ||
Heteroplasmic (45-100%) | 100.0% (1940/1940) | 100.0% |
Heteroplasmic (35-45%) | 100.0% (4/4) | 100.0% |
Heteroplasmic (25-35%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (15-25%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (10-15%) | 100.0% (9/9) | 100.0% |
Heteroplasmic (5-10%) | 92.3% (12/13) | 99.98% |
Heteroplasmic (<5%) | 88.9% (48/54) | 99.93% |
Insertions and deletions by sequence analysis n=40 indels | ||
Heteroplasmic (45-100%) 1-10bp | 100.0% (32/32) | 100.0% |
Heteroplasmic (5-45%) 1-10bp | 100.0% (3/3) | 100.0% |
Heteroplasmic (<5%) 1-10bp | 100.0% (5/5) | 99,997% |
SIMULATION DATA /(mitomap mutations) | ||
Insertions, and deletions 1-24 bps by sequence analysis; n=17 | ||
Homoplasmic (100%) 1-24bp | 100.0% (17/17) | 99.98% |
Heteroplasmic (50%) | 100.0% (17/17) | 99.99% |
Heteroplasmic (25%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (20%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (15%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (10%) | 94.1% (16/17) | 100.0% |
Heteroplasmic (5%) | 94.1% (16/17) | 100.0% |
Copy number variants (separate artifical mutations; n=1500) | ||
Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | 100.0% |
Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | 100.0% |
The performance presented above reached by following coverage metrics at assay level (n=66) | ||
Mean of medians | Median of medians | |
Mean sequencing depth MQ0 (clinical) | 18224X | 17366X |
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) | 100% | |
rho zero cell line (=no mtDNA), mean sequencing depth | 12X |
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists, and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.
The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.
Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost, according to our latest follow-up reporting policy.
Other
- GeneReviews - CLCN7-Related Osteopetrosis
- GeneReviews - Hypophosphatasia
- GeneReviews - X-Linked Hypophosphatemia
- International Osteoporosis Foundation
- Invalidiliitto
- NORD - Familial Hypophosphatemia
- NORD - Hypophosphatasia
- NORD - Osteogenesis Imperfecta
- OsteoPETrosis Society
- Osteogenesis Imperfecta Foundation
- Patient Info UK
- Suomen Osteogenesis Imperfecta -yhdistys
- XLH Network