Nephrolithiasis Panel

Summary
Is a 45 gene panel that includes assessment of non-coding variants.

Is ideal for patients with nephrolithiasis / hypercalciuria.

Analysis methods
  • PLUS
Availability
4 weeks
Number of genes
45
Test code
KI2201
Panel tier
Tier 2
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Nephrolithiasis Panel (test code KI2201):

Read about our accreditations, certifications and CE-marked IVD medical devices here.

ICD Codes

Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient’s name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Nephrolithiasis (kidney stone disease), is a frequent disorder with a prevalence between 5 and 10% in the general population. It is usually associated with a metabolic abnormality that may include hypercalciuria, hyperphosphaturia, hyperoxaluria, hypocitraturia, hyperuricosuria, cystinuria, a low urinary volume and a defect in urinary acidification. Genetic as well as environmental factors are thought to contribute to its pathogenesis. Hypercalciuric nephrolithiasis is a familial disorder in over 35% of patients. Monogenic forms of hypercalciuric nephrolithiasis include Bartter syndrome, Dent’s disease, autosomal dominant hypocalcemic hypercalciuria (ADHH), hypercalciuric nephrolithiasis with hypophosphatemia, and familial hypomagnesemia with hypercalciuria. Genes associated with nephrolithiasis encode for proteins including a number of transporters, channels and receptors that are involved in regulating the renal tubular reabsorption of calcium, phosphate and the activity of precipitation inhibitors. The majority (65% to 75%) of stones are composed of either pure or mostly of calcium salts, including those of calcium oxalate, mixed calcium oxalate with uric acid, and calcium phosphate (brushite). Uric acid, cystine, and magnesium ammonium phosphate (struvite) compose the remainder of the stones. Composition of the stone reflects metabolic abnormalities in the urine. The treatment is based on diagnosis, and genetic testing may help as biochemical testing does not usually lead to an accurate molecular diagnosis. Environmental and especially dietary factors are important in primary as well as in secondary prevention.

Genes in the Nephrolithiasis Panel and their clinical significance

To view complete table content, scroll horizontally.

Gene Associated phenotypes Inheritance ClinVar HGMD
ADCY10 Absorptive hypercalciuria AD 6
AGXT Hyperoxaluria AR 190 205
ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, infantile, juvenile and adult forms AD/AR 78 291
APRT Adenine phosphoribosyltransferase deficiency AR 11 47
ATP6V0A4 Renal tubular acidosis, distal AR 16 84
ATP6V1B1 Renal tubular acidosis with deafness AR 15 56
ATP7B Wilson disease AR 219 897
BSND Sensorineural deafness with mild renal dysfunction, Bartter syndrome AR 10 20
CA2 Osteopetrosis, with renal tubular acidosis AR 9 31
CASR Hypocalcemia, Neonatal hyperparathyroidism, Familial Hypocalciuric hypercalcemia with transient Neonatal hyperparathyroidism AD/AR 104 396
CLCN5 Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, Hypophosphatemic rickets,, Nephrolithiasis, I, Dent disease XL 48 272
CLCNKA* Bartter syndrome AR/Digenic 3 3
CLCNKB* Bartter syndrome AR 19 119
CLDN16 Hypomagnesemia, renal AR 21 62
CLDN19 Hypomagnesemia, renal AR 7 20
CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia (MEGCANN) AD/AR 26 25
CYP24A1 Hypercalcemia, infantile 1 AR 8 40
FAM20A Amelogenesis imperfecta (Enamel-renal syndrome) AR 19 41
FOXI1 Pendred syndrome, Enlarged vestibular aqueduct AR 1 11
GNA11 Hypocalcemia, Hypocalciuric hypercalcemia AD 11 11
GPHN Hyperekplexia, Molybdenum cofactor deficiency AD/AR 35 20
GRHPR Hyperoxaluria AR 60 40
HNF4A Congenital hyperinsulinism, diazoxide-responsive, Maturity onset diabetes of the young, Fanconi renotubular syndrome 4 with maturity-onset diabetes of the young AD 32 147
HOGA1 Hyperoxaluria AR 37 33
HPRT1 Lesch-Nyhan syndrome, Kelley-Seegmiller syndrome XL 72 427
KCNJ1 Bartter syndrome, antenatal AR 11 66
MAGED2 Bartter syndrome type 5, antenatal transient XL 6 7
MOCOS Xanthinuria, type II AR 3 5
MOCS1* Molybdenum cofactor deficiency AR 7 35
MOCS2 Molybdenum cofactor deficiency AR 10 16
OCRL Lowe syndrome, Dent disease XL 47 264
PRPS1* Phosphoribosylpyrophosphate synthetase I superactivity, Arts syndrome, Charcot-Marie-Tooth disease, X-linked recessive, 5, Deafness, X-linked 1 XL 27 32
SLC12A1 Bartter syndrome, antenatal AR 18 81
SLC22A12 Hypouricemia, renal 1 AR 8 40
SLC26A1 Nephrolithiasis, calcium oxalate AR 18 5
SLC2A9 Hypouricemia, renal, 2 AD/AR 9 20
SLC34A1 Nephrolithiasis/osteoporosis, hypophosphatemic, Fanconi renotubular syndrome, Hypercalcemia, infantile 2 AD/AR 22 29
SLC34A3 Hypophosphatemic rickets with hypercalciuria AR 22 38
SLC3A1 Cystinuria AR 26 241
SLC4A1 Spherocytosis, Ovalcytosis, Renal tubular acidosis, distal, with hemolytic anemia, Cryohydrocytosis, Acanthocytosis, Band 3 Memphis AD/AR/BG 38 122
SLC7A9 Cystinuria AD/AR 24 159
SLC9A3R1 Nephrolithiasis/osteoporosis, hypophosphatemic, 2 AD 7
UMOD Familial juvenile hyperuricemic nephropathy, Glomerulocystic kidney disease with hyperuricemia and isosthenuria, Medullary cystic kidney disease 2 AD 33 108
VDR Vitamin D-dependent rickets AD/AR 17 66
XDH Xanthinuria, type I AR 10 21
#

The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

*

Some, or all, of the gene is duplicated in the genome. Read more.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Nephrolithiasis Panel

To view complete table content, scroll horizontally.

Gene Genomic location HG19 HGVS RefSeq RS-number
ALPL Chr1:21835920 c.-195C>T NM_000478.4
ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4
ATP7B Chr13:52518439 c.3061-12T>A NM_000053.3
ATP7B Chr13:52585551 c.-78A>C NM_000053.3
ATP7B Chr13:52585596 c.-128_-124delAGCCG NM_000053.3
ATP7B Chr13:52585596 c.-123C>A NM_000053.3
ATP7B Chr13:52585606 c.-133A>C NM_000053.3
ATP7B Chr13:52585683 c.-210A>T NM_000053.3
ATP7B Chr13:52585894 NM_000053.3 rs1484840087
ATP7B Chr13:52585897 NM_000053.3
ATP7B Chr13:52585915 c.-442G>A NM_000053.3
CASR Chr3:121994640 c.1378-19A>C NM_001178065.1
CLDN16 Chr3:190127678 c.785-14T>G NM_006580.3
HNF4A Chr20:42984253 c.-192C>G NM_175914.4
HNF4A Chr20:42984264 c.-181G>A NM_175914.4
HNF4A Chr20:42984271 c.-174T>C NM_175914.4
HNF4A Chr20:42984276 c.-169C>T NM_175914.4
HNF4A Chr20:42984299 c.-146T>C NM_175914.4
HNF4A Chr20:42984309 c.-136A>G NM_175914.4
HNF4A Chr20:43036000 c.291-21A>G NM_000457.4
HPRT1 ChrX:133594415 c.27+47C>T NM_000194.2
HPRT1 ChrX:133625464 c.402+1229A>G NM_000194.2
HPRT1 ChrX:133628822 c.485+1202T>A NM_000194.2
HPRT1 ChrX:133632625 c.533-13T>G NM_000194.2
MOCS1 Chr6:39874534 c.*365_*366delAG NM_005943.5 rs397518419
MOCS1 Chr6:39876810 c.*7+6T>C NM_005943.5
MOCS1 Chr6:39894006 c.251-418delT NM_005943.5
OCRL ChrX:128674707 c.40-14A>G NM_000276.3
OCRL ChrX:128687279 c.239-4023A>G NM_000276.3
OCRL ChrX:128696350 c.940-11G>A NM_000276.3
SLC12A1 Chr15:48524910 c.976-14C>G NM_000338.2
SLC3A1 Chr2:44528119 c.1012-23C>G NM_000341.3
SLC4A1 Chr17:42340296 c.-62G>A NM_000342.3 rs387906565
SLC7A9 Chr19:33334874 c.978-17G>A NM_014270.4 rs45628833

Test Strengths

The strengths of this test include:

  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:

  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).

This test may not reliably detect the following:

  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

The performance metrics listed below are from an initial validation performed at our main laboratory in Finland.

The following described analytic validation involves the evaluation of reference samples to determine the ability of an assay to detect different types of variants. The sensitivity quoted in the analytic validation may not be an exact reflection of performance in a production (ie, realtime) environment and is not a guarantee of the assay’s clinical performance. 

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%

Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.

Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.

The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.

Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.