Comprehensive Muscular Dystrophy / Myopathy Panel
In addition, it also includes the maternally inherited mitochondrial genome.
Is ideal for patients with distal myopathy or a clinical suspicion of muscular dystrophy. Includes the smaller Nemaline Myopathy Panel, LGMD and Congenital Muscular Dystrophy Panel, Emery-Dreifuss Muscular Dystrophy Panel and Collagen Type VI-Related Disorders Panel.
- PLUS
Summary
The Blueprint Genetics Comprehensive Muscular Dystrophy / Myopathy Panel (test code NE0701):
Read about our accreditations, certifications and CE-marked IVD medical devices here.
ICD Codes
Refer to the most current version of ICD-10-CM manual for a complete list of ICD-10 codes.
Sample Requirements
- Blood (min. 1ml) in an EDTA tube
- Extracted DNA, min. 2 μg in TE buffer or equivalent
- Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient’s name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
Muscular dystrophies and myopathies are a complex group of neuromuscular or musculoskeletal disorders that typically result in progressive muscle weakness. The age of onset, affected muscle groups and additional symptoms depend on the type of the disease.
Limb girdle muscular dystrophy (LGMD) is a group of disorders with atrophy and weakness of proximal limb girdle muscles, typically sparing the heart and bulbar muscles. However, cardiac and respiratory impairment may be observed in certain forms of LGMD. In congenital muscular dystrophy (CMD), the onset of muscle weakness typically presents in the newborn period or early infancy. Clinical severity, age of onset, and disease progression are highly variable among the different forms of LGMD/CMD. Phenotypes overlap both within CMD subtypes and among the congenital muscular dystrophies, congenital myopathies, and LGMDs. Emery-Dreifuss muscular dystrophy (EDMD) is a condition that affects mainly skeletal muscle and heart. Usually it presents in early childhood with contractures, which restrict the movement of certain joints – most often elbows, ankles, and neck. Most patients also experience slowly progressive muscle weakness and wasting, beginning with the upper arm and lower leg muscles and progressing to shoulders and hips. Almost all patients with EDMD have cardiac involvement by adulthood. It presents clinically as cardiac conduction defects and/or arrhythmias. The cardiomyopathy phenotype is usually classified as dilated cardiomyopathy (DCM) but also ARVC and hypertrophic cardiomyopathies (HCM) have been described. A small proportion of patients with autosomal dominant EDMD experience cardiac manifestation without any skeletal muscle weakness or wasting.
Dystrophinopathies include a spectrum of muscle diseases ranging from asymptomatic with an increase in serum concentration of creatine phosphokinase to the severe progressive muscle diseases that are classified as Duchenne or Becker muscular dystrophy (DMD or BMD) when skeletal muscle is primarily affected and as DMD-associated DCM when the heart is primarily affected. DMD usually presents in early childhood with delayed milestones, including delays in sitting and standing independently. DMD is rapidly progressive, with affected children being wheelchair dependent by age 13 years and cardiomyopathy occurring soon after that. BMD is characterized by later onset skeletal muscle weakness; some individuals remain ambulatory into their 20s. However, heart failure from DCM is a common cause of death in the mid-40s. DMD-associated DCM is characterized by left ventricular dilation and congestive heart failure. Females heterozygous for a pathogenic variant in DMD are at increased risk for DCM.
The collagen type VI-related disorders are now recognized to be a continuum of overlapping phenotypes with Bethlem myopathy at the mild end and Ullrich congenital muscular dystrophy (UCMD) at the severe end. In between these phenotypes, there are collagen type VI-related limb-girdle muscular dystrophy and myosclerosis myopathy. Bethlem myopathy is characterized by proximal weakness and variable contractures. Elbows, ankles and fingers are most often affected. If the onset is in early childhood, delayed motor milestones, muscle weakness and contractures are evident. Adult onset patients require eventually ambulatory support. UCMD is characterized by congenital muscle weakness, proximal joint contractures, and striking hyperlaxity of distal joints. Affected children rarely gain the ability to walk independently and spinal rigidity and scoliosis develop. Respiratory failure is a common cause of death in the first and second decade of life. Intelligence is normal in both Bethlem myopathy and UCMD.
Nemaline Myopathy is characterized by weakness, hypotonia, and depressed or absent deep tendon reflexes. Histopathologically, nemaline bodies are detected on muscle biopsy. The clinical classification defines six forms of Nemaline Myopathy, which are classified by onset and severity of motor and respiratory involvement. Considerable overlap occurs among the forms.
Genes in the Comprehensive Muscular Dystrophy / Myopathy Panel and their clinical significance
To view complete table content, scroll horizontally.
Gene | Associated phenotypes | Inheritance | ClinVar | HGMD |
---|---|---|---|---|
ACAD9 | Acyl-CoA dehydrogenase family, deficiency | AR | 26 | 61 |
ACADVL | Acyl-CoA dehydrogenase, very long chain, deficiency | AR | 119 | 282 |
ACTA1 | Myopathy | AD/AR | 68 | 212 |
ADCK3 | Coenzyme Q10 deficiency, Progressive cerebellar ataxia and atrophy, Spinocerebellar ataxia | AR | 45 | 43 |
ANO5 | Gnathodiaphyseal dysplasia, LGMD2L and distal MMD3 muscular dystrophies | AD/AR | 64 | 121 |
ATP2A1 | Brody myopathy | AR | 19 | 18 |
B3GALNT2# | Muscular dystrophy-dystroglycanopathy | AR | 18 | 14 |
B4GAT1 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 | AR | 3 | 5 |
BAG3 | Dilated cardiomyopathy (DCM), Myopathy, myofibrillar | AD | 39 | 62 |
BICD2 | Childhood-onset proximal spinal muscular atrophy with contractures | AD | 12 | 28 |
BIN1 | Myopathy, centronuclear | AD/AR | 9 | 15 |
CAPN3 | Muscular dystrophy, limb-girdle, Eosinophilic myositis | AD/AR | 184 | 437 |
CASQ1 | Myopathy, vacuolar, with CASQ1 aggregates | AD | 2 | 5 |
CAV3 | Creatine phosphokinase, elevated serum, Hypertrophic cardiomyopathy (HCM), Long QT syndrome, Muscular dystrophy, limb-girdle, type IC, Myopathy, distal, Tateyama type, Rippling muscle disease 2 | AD/AR | 23 | 50 |
CFL2 | Nemaline myopathy | AR | 2 | 9 |
CHKB | Muscular dystrophy, congenital, megaconial | AR | 11 | 27 |
CNTN1 | Myopathy, congenital, Compton-North | AR | 5 | 2 |
COL12A1 | Bethlem myopathy, Ullrich congenital muscular dystrophy | AD/AR | 14 | 13 |
COL4A1 | Schizencephaly, Anterior segment dysgenesis with cerebral involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease | AD | 58 | 107 |
COL4A2 | Hemorrhage, intracerebral | AD | 14 | 12 |
COL6A1 | Bethlem myopathy, Ullrich congenital muscular dystrophy | AD/AR | 81 | 132 |
COL6A2 | Epilepsy, progressive myoclonic, Bethlem myopathy, Myosclerosis, congenital, Ullrich congenital muscular dystrophy | AD/AR | 101 | 182 |
COL6A3 | Bethlem myopathy, Dystonia, Ullrich congenital muscular dystrophy | AD/AR | 68 | 138 |
COQ2 | Coenzyme Q10 deficiency | AR | 16 | 31 |
CRYAB | Cataract, myofibrillar myopathy and cardiomyopathy, Congenital cataract and cardiomyopathy, Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Cataract 16, multiple types, Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related | AD | 14 | 28 |
DAG1 | Muscular dystrophy-dystroglycanopathy | AR | 12 | 10 |
DES | Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Scapuloperoneal syndrome, neurogenic, Kaeser type | AD/AR | 64 | 124 |
DGUOK | Mitochondrial DNA depletion syndrome, Portal hypertension, noncirrhotic, Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4 | AR | 23 | 62 |
DMD | Becker muscular dystrophy, Duchenne muscular dystrophy, Dilated cardiomyopathy (DCM) | XL | 832 | 3915 |
DNAJB6 | Muscular dystrophy, limb-girdle | AD | 11 | 17 |
DPM3 | Congenital disorder of glycosylation, Dilated cardiomyopathy (DCM), Limb-girdle muscular dystrophy | AR | 3 | 2 |
DYSF | Miyoshi muscular dystrophy, Muscular dystrophy, limb-girdle, Myopathy, distal, with anterior tibial onset | AR | 244 | 529 |
EMD | Emery-Dreifuss muscular dystrophy | XL | 48 | 113 |
FDX1L | Myopathy | AR | 1 | 2 |
FHL1* | Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy | XL | 26 | 62 |
FKRP | Muscular dystrophy-dystroglycanopathy | AR | 66 | 140 |
FKTN | Muscular dystrophy-dystroglycanopathy, Dilated cardiomyopathy (DCM), Muscular dystrophy-dystroglycanopathy (limb-girdle) | AR | 45 | 58 |
FLAD1 | Lipid storage myopathy due to FLAD1 deficiency (LSMFLAD) | AR | 9 | 10 |
FLNC* | Myopathy, Cardiomyopathy | AD | 54 | 109 |
GAA | Glycogen storage disease | AR | 193 | 573 |
GBE1 | Glycogen storage disease | AR | 36 | 70 |
GMPPB | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), Limb-girdle muscular dystrophy-dystroglycanopathy | AR | 19 | 41 |
GOLGA2 | Microcephaly, seizures, and developmental delay | AR | 2 | |
GYG1 | Glycogen storage disease, Polyglucosan body myopathy 2 | AR | 9 | 16 |
HNRNPDL | Muscular dystrophy, limb-girdle, type 1G | AD | 3 | 2 |
INPP5K | Muscular dystrophy, congenital, with cataracts and intellectual disability (MDCCAID) | AR | 8 | 10 |
ISCU | Myopathy with lactic acidosis | AR | 3 | 3 |
ISPD | Muscular dystrophy-dystroglycanopathy | AR | 38 | 53 |
ITGA7 | Muscular dystrophy, congenital, due to integrin alpha-7 deficiency | AR | 16 | 8 |
KBTBD13 | Nemaline myopathy | AD | 4 | 10 |
KLHL40 | Nemaline myopathy | AR | 11 | 26 |
KLHL41 | Nemaline myopathy | AR | 8 | 8 |
LAMA2 | Muscular dystrophy, congenital merosin-deficient | AR | 199 | 301 |
LAMP2 | Danon disease | XL | 62 | 101 |
LARGE | Muscular dystrophy-dystroglycanopathy | AR | 19 | 27 |
LDB3 | Dilated cardiomyopathy (DCM), Myopathy, myofibrillar | AD | 9 | 14 |
LIMS2 | Muscular dystrophy, limb-girdle | AR | 2 | 3 |
LMNA | Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type | AD/AR | 250 | 564 |
LMOD3 | Severe congenital nemaline myopathy, Typical nemaline myopathy | AR | 8 | 15 |
MAP3K20 | Centronuclear myopathy | AR | 5 | 7 |
MEGF10 | Myopathy, early-onset, areflexia, respiratory distress, and dysphagia | AR | 20 | 19 |
MICU1 | Myopathy with extrapyramidal signs | AR | 10 | 8 |
MME | Spinocerebellar ataxia 43, Charcot-Marie-Tooth disease, axonal, type 2T | AD/AR | 14 | 21 |
MSTO1#* | Myopathy, mitochondrial, and ataxia | AR | 7 | 8 |
MT-ATP6 | Neuropathy, ataxia, and retinitis pigmentosa, Leber hereditary optic neuropathy, Ataxia and polyneuropathy, adult-onset, Cardiomyopathy, infantile hypertrophic, Leigh syndrome, Striatonigral degeneration, infantile, mitochondrial | Mitochondrial | 19 | |
MT-ATP8 | Cardiomyopathy, apical hypertrophic, and neuropathy, Cardiomyopathy, infantile hypertrophic | Mitochondrial | 4 | |
MT-CO1 | Myoglobinuria, recurrent, Leber hereditary optic neuropathy, Sideroblastic anemia, Cytochrome C oxidase deficiency, Deafness, mitochondrial | Mitochondrial | 17 | |
MT-CO2 | Cytochrome c oxidase deficiency | Mitochondrial | 8 | |
MT-CO3 | Cytochrome c oxidase deficiency, Leber hereditary optic neuropathy | Mitochondrial | 9 | |
MT-CYB | Mitochondrial | 69 | ||
MT-ND1 | Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia | Mitochondrial | 21 | |
MT-ND2 | Leber hereditary optic neuropathy, Mitochondrial complex I deficiency | Mitochondrial | 6 | |
MT-ND3 | Leber optic atrophy and dystonia, Mitochondrial complex I deficiency | Mitochondrial | 7 | |
MT-ND4 | Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency | Mitochondrial | 11 | |
MT-ND4L | Leber hereditary optic neuropathy | Mitochondrial | 2 | |
MT-ND5 | Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Mitochondrial complex I deficiency | Mitochondrial | 19 | |
MT-ND6 | Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Oncocytoma, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency | Mitochondrial | 16 | |
MT-RNR1 | Deafness, mitochondrial | Mitochondrial | 3 | |
MT-RNR2 | Chloramphenicol toxicity/resistance | Mitochondrial | 2 | |
MT-TA | Mitochondrial | 4 | ||
MT-TC | Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes | Mitochondrial | 3 | |
MT-TD | Mitochondrial | 1 | ||
MT-TE | Diabetes-deafness syndrome, Mitochondrial myopathy, infantile, transient, Mitochondrial myopathy with diabetes | Mitochondrial | 5 | |
MT-TF | Myoclonic epilepsy with ragged red fibers, Nephropathy, tubulointerstitial, Encephalopathy, mitochondrial, Epilepsy, mitochondrial, Myopathy, mitochondrial, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes | Mitochondrial | 7 | |
MT-TG | Mitochondrial | 3 | ||
MT-TH | Mitochondrial | 4 | ||
MT-TI | Mitochondrial | 7 | ||
MT-TK | Myoclonic epilepsy with ragged red fibers, Leigh syndrome | Mitochondrial | 5 | |
MT-TL1 | Cytochrome c oxidase deficiency, Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Diabetes-deafness syndrome, Cyclic vomiting syndrome, SIDS, susceptibility to | Mitochondrial | 14 | |
MT-TL2 | Mitochondrial multisystemic disorder, Progressive external ophthalmoplegia, Mitochondrial Myopathy, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes | Mitochondrial | 5 | |
MT-TM | Leigh syndrome, Mitochondrial multisystemic disorder | Mitochondrial | 1 | |
MT-TN | Progressive external ophthalmoplegia, Mitochondrial multisystemic disorder | Mitochondrial | 3 | |
MT-TP | Mitochondrial | 2 | ||
MT-TQ | Mitochondrial multisystemic disorder | Mitochondrial | 2 | |
MT-TR | Encephalopathy, mitochondrial | Mitochondrial | 2 | |
MT-TS1 | Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes | Mitochondrial | 10 | |
MT-TS2 | Mitochondrial multisystemic disorder | Mitochondrial | 2 | |
MT-TT | Mitochondrial | 5 | ||
MT-TV | Hypertrophic cardiomyopathy (HCM), Leigh syndrome, Mitochondrial multisystemic disorder, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes | Mitochondrial | 3 | |
MT-TW | Leigh syndrome, Myopathy, mitochondrial | Mitochondrial | 8 | |
MT-TY | Mitochondrial multisystemic disorder | Mitochondrial | 4 | |
MTM1 | Myopathy, centronuclear | XL | 158 | 301 |
MYH7 | Hypertrophic cardiomyopathy (HCM), Myopathy, myosin storage, Myopathy, distal, Dilated cardiomyopathy (DCM) | AD | 305 | 986 |
MYO18B | Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism | AR | 2 | 4 |
MYOT | Myopathy, myofibrillar, Muscular dystrophy, limb-girdle, 1A, Myopathy, spheroid body | AD | 6 | 16 |
NEB#* | Nemaline myopathy | AR | 305 | 309 |
PABPN1 | Oculopharyngeal muscular dystrophy | AD/AR | 6 | 23 |
PGK1 | Phosphoglycerate kinase 1 deficiency | XL | 16 | 26 |
PHKA1 | Glycogen storage disease | XL | 9 | 8 |
PHKB | Glycogen storage disease | AR | 9 | 26 |
PLEC | Muscular dystrophy, limb-girdle, Epidermolysis bullosa | AD/AR | 36 | 103 |
PNPLA2 | Neutral lipid storage disease with myopathy | AR | 13 | 35 |
POGLUT1 | Dowling-Degos disease 4, Muscular dystrophy, limb-girdle, type 2Z | AD/AR | 6 | 13 |
POLG | POLG-related ataxia neuropathy spectrum disorders, Sensory ataxia, dysarthria, and ophthalmoparesis, Alpers syndrome, Progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial DNA depletion syndrome | AD/AR | 89 | 290 |
POLG2 | Progressive external ophthalmoplegia with mitochondrial DNA deletions | AD | 5 | 14 |
POMGNT1 | Muscular dystrophy-dystroglycanopathy | AR | 96 | 88 |
POMGNT2 | Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 8 | AR | 6 | 9 |
POMK | Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A, 12, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type C, 12, Muscle-eye brain disease, Walker-Warburg syndrome | AR | 6 | 8 |
POMT1 | Muscular dystrophy-dystroglycanopathy | AR | 47 | 96 |
POMT2 | Muscular dystrophy-dystroglycanopathy | AR | 45 | 73 |
PYGM | Glycogen storage disease | AR | 77 | 168 |
PYROXD1* | Myopathy, myofibrillar 8 | AR | 5 | 6 |
RBCK1 | Polyglucosan body myopathy | AR | 11 | 14 |
RRM2B | Progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial DNA depletion syndrome | AD/AR | 41 | 41 |
RYR1 | Central core disease, Malignant hyperthermia, Minicore myopathy with external ophthalmoplegia, Centronuclear myopathy, Minicore myopathy, Multicore myopathy | AD/AR | 241 | 666 |
SCN4A | Hyperkalemic periodic paralysis, Myotonia, potassium-aggravated, Paramyotonia congenita, Myasthenic syndrome, congenital, Normokalemic potassium-sensitive periodic paralysis | AD/AR | 57 | 126 |
SELENON# | Muscular dystrophy, rigid spine, Myopathy, congenital, with fiber- disproportion | AR | 38 | 63 |
SEPT9 | Amyotrophy, hereditary neuralgic | AD | 4 | 11 |
SGCA | Muscular dystrophy, limb-girdle | AR | 60 | 100 |
SGCB | Muscular dystrophy, limb-girdle | AR | 37 | 64 |
SGCD | Muscular dystrophy, limb-girdle, Dilated cardiomyopathy (DCM) | AR | 21 | 27 |
SGCG | Muscular dystrophy, limb-girdle | AR | 33 | 63 |
SIL1 | Marinesco-Sjogren syndrome | AR | 14 | 49 |
SLC22A5 | Carnitine deficiency, systemic primary | AR | 98 | 151 |
SLC25A20 | Carnitine-acylcarnitine translocase deficiency | AR | 15 | 42 |
SMCHD1 | Facioscapulohumeral muscular dystrophy, Facioscapulohumeral muscular dystrophy, type 2 | AD | 51 | 79 |
SMN1#* | Spinal muscular atrophy | AR | 29 | 111 |
SMN2#* | Spinal muscular atrophy | AD | 1 | 9 |
SPEG | Centronuclear myopathy 5 | AR | 5 | 11 |
SPTBN4 | Myopathy, congenital, with neuropathy and deafness | AR | 6 | 7 |
STAC3 | Native American myopathy | 3 | 4 | |
SUCLA2 | Mitochondrial DNA depletion syndrome | AR | 9 | 29 |
SUCLG1 | Mitochondrial DNA depletion syndrome | AR | 12 | 28 |
SYNE1 | Spinocerebellar ataxia, autosomal recessive 8 | AD/AR | 83 | 136 |
TANGO2 | Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration (MECRCN) | AR | 13 | 9 |
TCAP | Muscular dystrophy, limb-girdle, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) | AD/AR | 12 | 28 |
TIA1 | Welander distal myopathy | AD | 1 | 13 |
TMEM126B | Mitochondrial complex I deficiency | AR | 4 | 4 |
TMEM43 | Arrhythmogenic right ventricular dysplasia, Emery-Dreifuss muscular dystrophy | AD | 4 | 24 |
TNNT1 | Nemaline myopathy | AR | 6 | 8 |
TNPO3 | Muscular dystrophy, limb-girdle | AD | 3 | 5 |
TOR1AIP1 | Muscular dystrophy with progressive weakness, distal contractures and rigid spine | AD/AR | 3 | 5 |
TPM2 | CAP myopathy, Nemaline myopathy, Arthrogryposis, distal | AD | 18 | 38 |
TPM3* | CAP myopathy, Nemaline myopathy, Myopathy, congenital, with fiber- disproportion | AD/AR | 21 | 27 |
TRAPPC11 | Limb-girdle muscular dystrophy | AR | 13 | 17 |
TRIM32 | Bardet-Biedl syndrome, Muscular dystrophy, limb-girdle | AR | 13 | 16 |
TSFM# | Combined oxidative phosphorylation deficiency | AR | 6 | 6 |
TTN* | Dilated cardiomyopathy (DCM), Tibial muscular dystrophy, Limb-girdle muscular dystrophy, Hereditary myopathy with early respiratory failure, Myopathy, early-onset, with fatal cardiomyopathy (Salih myopathy), Muscular dystrophy, limb-girdle, type 2J | AD/AR | 818 | 327 |
TYMP | Mitochondrial DNA depletion syndrome | AR | 84 | 94 |
VMA21 | Myopathy, X-linked, with excessive autophagy | XL | 9 | 11 |
VPS13A | Choreoacanthocytosis | AR | 19 | 115 |
The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
Some, or all, of the gene is duplicated in the genome. Read more.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding variants covered by Comprehensive Muscular Dystrophy / Myopathy Panel
To view complete table content, scroll horizontally.
Gene | Genomic location HG19 | HGVS | RefSeq | RS-number |
---|---|---|---|---|
ACADVL | Chr17:7123160 | c.-144_-132delCCCAGCATGCCCCinsT | NM_000018.3 | |
ACADVL | Chr17:7125469 | c.822-27C>T | NM_001270447.1 | rs374911841 |
ACADVL | Chr17:7125485 | c.822-11T>G | NM_001270447.1 | |
ACADVL | Chr17:7126199 | c.1146+15C>T | NM_001270447.1 | rs202237278 |
ACADVL | Chr17:7126948 | c.1252-15A>G | NM_001270447.1 | rs765390290 |
ACADVL | Chr17:7127894 | c.1747+23C>T | NM_001270447.1 | rs147546456 |
ADCK3 | Chr1:227174508 | c.*72dupG | NM_020247.4 | |
CAPN3 | Chr15:42678352 | c.380-13T>A | NM_000070.2 | |
CAPN3 | Chr15:42695919 | c.1746-20C>T | NM_000070.2 | |
CAPN3 | Chr15:42697047 | c.-188G>C | NM_173089.1 | |
CAPN3 | Chr15:42702715 | c.2184+21G>A | NM_000070.2 | rs763572829 |
CAPN3 | Chr15:42702770 | c.2185-16A>G | NM_000070.2 | |
COL4A1 | Chr13:110802675 | c.*35C>A | NM_001845.4 | |
COL4A1 | Chr13:110802678 | c.*32G>A/T | NM_001845.4 | |
COL4A1 | Chr13:110802679 | c.*31G>T | NM_001845.4 | |
COL6A1 | Chr21:47409500 | c.859-22A>G | NM_001848.2 | rs398123642 |
COL6A1 | Chr21:47409627 | c.904-39A>G | NM_001848.2 | |
COL6A1 | Chr21:47409881 | c.930+189C>T | NM_001848.2 | |
COL6A1 | Chr21:47413935 | c.1336-146C>T | NM_001848.2 | |
COL6A2 | Chr21:47538492 | c.1117-35_1118dupAAAAGACGTGAGGCTGATTCTGCAAACCCTTCCAGGG | NM_001849.3 | |
COL6A2 | Chr21:47541407 | c.1459-63G>A | NM_001849.3 | |
COL6A3 | Chr2:238268046 | c.6283-15C>A | NM_004369.3 | |
DGUOK | Chr2:74177650 | c.444-62C>A | NM_080916.2 | |
DGUOK | Chr2:74177701 | c.444-11C>G | NM_080916.2 | rs536746349 |
DMD | ChrX:31165653 | c.10554-18C>G | NM_004006.2 | |
DMD | ChrX:31200680 | c.9974+175T>A | NM_004006.2 | |
DMD | ChrX:31224814 | c.9564-30A>T | NM_004006.2 | |
DMD | ChrX:31225211 | c.9564-427T>G | NM_004006.2 | |
DMD | ChrX:31226400 | c.9563+1215A>G | NM_004006.2 | |
DMD | ChrX:31229031 | c.9362-1215A>G | NM_004006.2 | |
DMD | ChrX:31241047 | c.9361+117A>G | NM_004006.2 | |
DMD | ChrX:31279293 | c.9225-160A>G | NM_004006.2 | |
DMD | ChrX:31279418 | c.9225-285A>G | NM_004006.2 | |
DMD | ChrX:31279420 | c.9225-287C>A | NM_004006.2 | |
DMD | ChrX:31279780 | c.9225-647A>G | NM_004006.2 | rs398124091 |
DMD | ChrX:31279781 | c.9225-648A>G | NM_004006.2 | rs398124084 |
DMD | ChrX:31332523 | c.9224+9192C>A | NM_004006.2 | |
DMD | ChrX:31382270 | c.9085-15519G>T | NM_004006.2 | |
DMD | ChrX:31613687 | c.8217+32103G>T | NM_004006.2 | |
DMD | ChrX:31627738 | c.8217+18052A>G | NM_004006.2 | |
DMD | ChrX:31697714 | c.7661-11T>C | NM_004006.2 | |
DMD | ChrX:31897527 | c.6913-4037T>G | NM_004006.2 | |
DMD | ChrX:31983146 | c.6614+3310G>T | NM_004006.2 | rs797045526 |
DMD | ChrX:32274692 | c.6290+30954C>T | NM_004006.2 | |
DMD | ChrX:32305833 | c.6118-15A>G | NM_004006.2 | |
DMD | ChrX:32360414 | c.5740-15G>T | NM_004006.2 | |
DMD | ChrX:32366860 | c.5326-215T>G | NM_004006.2 | |
DMD | ChrX:32379144 | c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA | NM_004006.2 | |
DMD | ChrX:32398808 | c.4675-11A>G | NM_004006.2 | |
DMD | ChrX:32460274 | c.3787-843C>A | NM_004006.2 | |
DMD | ChrX:32470726 | c.3603+2053G>C | NM_004006.2 | |
DMD | ChrX:32479316 | c.3432+2240A>G | NM_004006.2 | |
DMD | ChrX:32479520 | c.3432+2036A>G | NM_004006.2 | |
DMD | ChrX:32669100 | c.961-5831C>T | NM_004006.2 | rs398124099 |
DMD | ChrX:32669194 | c.961-5925A>C | NM_004006.2 | |
DMD | ChrX:32716130 | c.832-15A>G | NM_004006.2 | rs72470513 |
DMD | ChrX:32756908 | c.650-39498A>G | NM_004006.2 | |
DMD | ChrX:32827744 | c.531-16T>A/G | NM_004006.2 | |
DMD | ChrX:32827744 | c.531-16T>A | NM_004006.2 | |
DMD | ChrX:32827744 | c.531-16T>G | NM_004006.2 | |
DMD | ChrX:32841967 | c.265-463A>G | NM_004006.2 | |
DMD | ChrX:33032666 | c.93+5590T>A | NM_004006.2 | |
DMD | ChrX:33192452 | c.31+36947G>A | NM_004006.2 | |
DMD | ChrX:33229483 | c.-54T>A | NM_004006.2 | |
DYSF | Chr2:71817308 | c.3443-33A>G | NM_003494.3 | rs786205083 |
DYSF | Chr2:71840553 | c.4410+13T>G | NM_003494.3 | |
DYSF | Chr2:71889030 | c.4886+1249G>T | NM_003494.3 | |
DYSF | Chr2:71900503 | c.5668-824C>T | NM_003494.3 | |
DYSF | Chr2:71913729 | c.*107T>A | NM_003494.3 | rs11903223 |
EMD | ChrX:153608559 | c.266-27_266-10delTCTGCTACCGCTGCCCCC | NM_000117.2 | |
FKRP | Chr19:47249328 | c.-272G>A | NM_024301.4 | |
FKTN | Chr9:108368857 | c.648-1243G>T | NM_006731.2 | |
GAA | Chr17:78078341 | c.-32-13T>A | NM_000152.3 | |
GAA | Chr17:78078341 | c.-32-13T>G | NM_000152.3 | rs386834236 |
GAA | Chr17:78078351 | c.-32-3C>A/G | NM_000152.3 | |
GAA | Chr17:78078352 | c.-32-2A>G | NM_000152.3 | |
GAA | Chr17:78078353 | c.-32-1G>C | NM_000152.3 | |
GAA | Chr17:78078369 | c.-17C>T | NM_000152.3 | |
GAA | Chr17:78082266 | c.1076-22T>G | NM_000152.3 | rs762260678 |
GAA | Chr17:78090422 | c.2190-345A>G | NM_000152.3 | |
GAA | Chr17:78092432 | c.2647-20T>G | NM_000152.3 | |
GBE1 | Chr3:81542964 | c.2053-3358_2053-3350delGTGTGGTGGinsTGTTTTTTACATGACAGGT | NM_000158.3 | rs869320698 |
GMPPB | Chr3:49761246 | c.-87C>T | NM_013334.3 | rs780961444 |
GYG1 | Chr3:148717967 | c.481+3276C>G | NM_004130.3 | |
ISCU | Chr12:108961426 | c.418+382G>C | NM_213595.2 | rs767000507 |
LAMA2 | Chr6:129633984 | c.3175-22G>A | NM_000426.3 | rs777129293 |
LAMA2 | Chr6:129636608 | c.3556-13T>A | NM_000426.3 | rs775278003 |
LAMA2 | Chr6:129714172 | c.5235-18G>A | NM_000426.3 | rs188365084 |
LAMA2 | Chr6:129835506 | c.8989-12C>G | NM_000426.3 | rs144860334 |
LMNA | Chr1:156100609 | c.513+45T>G | NM_170707.3 | |
LMNA | Chr1:156105681 | c.937-11C>G | NM_170707.3 | rs267607645 |
LMNA | Chr1:156107037 | c.1608+14G>A | NM_170707.3 | |
LMNA | Chr1:156107433 | c.1609-12T>G | NM_170707.3 | rs267607582 |
MTM1 | ChrX:149767035 | c.137-19_137-16delACTT | NM_000252.2 | |
MTM1 | ChrX:149767045 | c.137-11T>A | NM_000252.2 | |
MTM1 | ChrX:149783032 | c.232-26_232-23delGACT | NM_000252.2 | |
MTM1 | ChrX:149808833 | c.529-909A>G | NM_000252.2 | |
MTM1 | ChrX:149818176 | c.868-13T>A | NM_000252.2 | |
NEB | Chr2:152355017 | c.24220-151C>A | NM_001271208.1 | |
NEB | Chr2:152410918 | c.19429-381_19429-379delTTTinsA | NM_001271208.1 | |
PGK1 | ChrX:77381262 | c.1214-25T>G | NM_000291.3 | |
POMT1 | Chr9:134379574 | c.-30-2A>G | NM_007171.3 | |
POMT2 | Chr14:77751989 | c.1333-14G>A | NM_013382.5 | |
PYGM | Chr11:64523631 | c.661-601G>A | NM_005609.2 | |
PYGM | Chr11:64525847 | c.425-26A>G | NM_005609.2 | rs764313717 |
RYR1 | Chr19:38997317 | c.8692+131G>A | NM_000540.2 | |
RYR1 | Chr19:39074134 | c.14647-1449A>G | NM_000540.2 | rs193922886 |
SELENON | Chr1:26143316 | c.*1107T>C | NM_020451.2 | |
SEPT9 | Chr17:75316275 | c.-134G>C | NM_006640.4 | rs80338760 |
SGCA | Chr17:48246419 | c.585-31_585-23delTCTGCTGAC | NM_000023.2 | |
SGCA | Chr17:48246421 | c.585-31_585-24delTCTGCTGA | NM_000023.2 | |
SGCA | Chr17:48247492 | c.748-12_748-11delCTinsAA | NM_000023.2 | |
SGCG | Chr13:23755086 | c.-127_-121delACAGTTG | NM_000231.2 | rs1422849467 |
SGCG | Chr13:23755215 | c.-1+1G>T | NM_000231.2 | |
SIL1 | Chr5:138283180 | c.1030-18G>A | NM_022464.4 | rs769052639 |
SLC22A5 | Chr5:131714054 | c.394-16T>A | NM_003060.3 | rs775097754 |
SLC22A5 | Chr5:131722665 | c.825-52G>A | NM_003060.3 | |
SMCHD1 | Chr18:2701019 | c.1647+103A>G | NM_015295.2 | |
SMCHD1 | Chr18:2705677 | c.1843-15A>G | NM_015295.2 | |
SMCHD1 | Chr18:2743740 | c.3634-19A>G | NM_015295.2 | |
SYNE1 | Chr6:152640163 | c.16237-13C>G | NM_182961.3 | |
SYNE1 | Chr6:152643033 | c.15918-12A>G | NM_182961.3 | rs606231134 |
VMA21 | ChrX:150572076 | c.54-27A>C/T | NM_001017980.3 | |
VMA21 | ChrX:150572076 | c.54-27A>C | NM_001017980.3 | rs878854352 |
VMA21 | ChrX:150572076 | c.54-27A>T | NM_001017980.3 | |
VMA21 | ChrX:150572082 | c.54-16_54-8delGTTTACTTT | NM_001017980.3 | rs878854357 |
Test Strengths
The strengths of this test include:
- CAP accredited laboratory
- CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
- Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
- Careful construction of clinically effective and scientifically justified gene panels
- Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
- Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
- ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
- Our rigorous variant classification scheme
- Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
- Our comprehensive clinical statements
Test Limitations
The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: *B3GALNT2* (NM_001277155:2), *SELENON* (NM_020451:3), *TSFM* (NM_001172696:5). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not detect the following:
- Complex inversions
- Gene conversions
- Balanced translocations
- Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
- Repeat expansion disorders unless specifically mentioned
- Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
- Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
- Stretches of mononucleotide repeats
- Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
- Indels larger than 50bp
- Single exon deletions or duplications
- Variants within pseudogene regions/duplicated segments
- Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section.
The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.
Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).
Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.
The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Marlborough, MA, are equivalent.
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Sensitivity % (TP/(TP+FN) | Specificity % | |
---|---|---|
Single nucleotide variants | 99.89% (99,153/99,266) | >99.9999% |
Insertions, deletions and indels by sequence analysis | ||
1-10 bps | 99.2% (7,745/7,806) | >99.9999% |
11-50 bps | 99.13% (2,524/2,546) | >99.9999% |
Copy number variants (exon level dels/dups) | ||
1 exon level deletion (heterozygous) | 100% (20/20) | NA |
1 exon level deletion (homozygous) | 100% (5/5) | NA |
1 exon level deletion (het or homo) | 100% (25/25) | NA |
2-7 exon level deletion (het or homo) | 100% (44/44) | NA |
1-9 exon level duplication (het or homo) | 75% (6/8) | NA |
Simulated CNV detection | ||
5 exons level deletion/duplication | 98.7% | 100.00% |
Microdeletion/-duplication sdrs (large CNVs, n=37)) | ||
Size range (0.1-47 Mb) | 100% (25/25) | |
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics | ||
Mean sequencing depth | 143X | |
Nucleotides with >20x sequencing coverage (%) | 99.86% |
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
Sensitivity % | Specificity % | |
---|---|---|
ANALYTIC VALIDATION (NA samples; n=4) | ||
Single nucleotide variants | ||
Heteroplasmic (45-100%) | 100.0% (50/50) | 100.0% |
Heteroplasmic (35-45%) | 100.0% (87/87) | 100.0% |
Heteroplasmic (25-35%) | 100.0% (73/73) | 100.0% |
Heteroplasmic (15-25%) | 100.0% (77/77) | 100.0% |
Heteroplasmic (10-15%) | 100.0% (74/74) | 100.0% |
Heteroplasmic (5-10%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (<5%) | 50.0% (2/4) | 100.0% |
CLINICAL VALIDATION (n=76 samples) | ||
All types | ||
Single nucleotide variants n=2026 SNVs | ||
Heteroplasmic (45-100%) | 100.0% (1940/1940) | 100.0% |
Heteroplasmic (35-45%) | 100.0% (4/4) | 100.0% |
Heteroplasmic (25-35%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (15-25%) | 100.0% (3/3) | 100.0% |
Heteroplasmic (10-15%) | 100.0% (9/9) | 100.0% |
Heteroplasmic (5-10%) | 92.3% (12/13) | 99.98% |
Heteroplasmic (<5%) | 88.9% (48/54) | 99.93% |
Insertions and deletions by sequence analysis n=40 indels | ||
Heteroplasmic (45-100%) 1-10bp | 100.0% (32/32) | 100.0% |
Heteroplasmic (5-45%) 1-10bp | 100.0% (3/3) | 100.0% |
Heteroplasmic (<5%) 1-10bp | 100.0% (5/5) | 99,997% |
SIMULATION DATA /(mitomap mutations) | ||
Insertions, and deletions 1-24 bps by sequence analysis; n=17 | ||
Homoplasmic (100%) 1-24bp | 100.0% (17/17) | 99.98% |
Heteroplasmic (50%) | 100.0% (17/17) | 99.99% |
Heteroplasmic (25%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (20%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (15%) | 100.0% (17/17) | 100.0% |
Heteroplasmic (10%) | 94.1% (16/17) | 100.0% |
Heteroplasmic (5%) | 94.1% (16/17) | 100.0% |
Copy number variants (separate artifical mutations; n=1500) | ||
Homoplasmic (100%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (50%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (30%) 500 bp, 1kb, 5 kb | 100.0% | 100.0% |
Heteroplasmic (20%) 500 bp, 1kb, 5 kb | 99.7% | 100.0% |
Heteroplasmic (10%) 500 bp, 1kb, 5 kb | 99.0% | 100.0% |
The performance presented above reached by following coverage metrics at assay level (n=66) | ||
Mean of medians | Median of medians | |
Mean sequencing depth MQ0 (clinical) | 18224X | 17366X |
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) | 100% | |
rho zero cell line (=no mtDNA), mean sequencing depth | 12X |
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen,MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.
We provide customers with comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our Ph.D. molecular geneticists, medical professionals, and other highly experienced experts prepare clinical reports by evaluating the identified variants in the context of the phenotypic information provided in the requisition form.
Our goal is to provide clinically meaningful reports that are understandable for all medical professionals regardless of whether they have formal training in genetics. Variant classification is the cornerstone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015. Sequence and copy number variants classified as pathogenic, likely pathogenic, and variants of uncertain significance (VUS) are confirmed using bidirectional Sanger sequencing or by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.
Our clinical report includes tables for sequence and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, phenotypes, and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene, and phenotype(s), including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts, and detailed information about related phenotypes. We also provide links to the references, abstracts, and variant databases used to help ordering providers further evaluate the reported findings if desired.
The panel report is divided into primary findings and additional findings sections. Variants reported as primary findings are known disease-causing variants or rare variants that could potentially explain the patient’s phenotype as described to the laboratory at the time of interpretation. The conclusion summarizes all the existing information and provides our rationale for the classification of the variant.
Variants reported as additional findings are variants that are not likely or sufficient to cause the tested patient’s phenotype, based on the current knowledge. Additional findings in panel reports include variants that are, for example, carrierships of single heterozygous variants in genes associated with autosomal recessive disorders, variants of uncertain significance in genes associated with autosomal dominant disorders (if pathogenic or likely pathogenic variants considered sufficient to explain the patient’s phenotype are reported as primary findings), or risk alleles identified in genes included in the panel.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well positioned to reclassify previously reported variants as new information becomes available. If a variant previously reported as a primary or secondary finding by Blueprint Genetics is reclassified so that it becomes diagnostic (VUS to P/LP) or earlier molecular diagnosis is removed (P/LP to VUS, LB, B), our laboratory will issue a follow-up statement to the original ordering healthcare provider at no additional cost.
Other
- Cure CMD
- Duchenne Alliance
- Duchenne Foundation
- Fighting Duchenne Foundation
- Foundation Building Strength for Nemaline Myopathy
- GeneReviews - Becker/Duchenne Muscular Dystrophy
- GeneReviews - Congenital Muscular Dystrophy
- GeneReviews - Emery-Dreifuss Muscular Dystrophy
- GeneReviews - Fukuyama Congenital Muscular Dystrophy
- GeneReviews - Limb-Girdle Muscular Dystrophy
- GeneReviews - Nemaline Myopathy
- GeneReviews - X-linked Myotubular Myopathy
- Joshua Frase Foundation
- LGMD-Info
- LGMD2I Research Fund
- Muscular Dystrophy Association
- Muscular Dystrophy Campaign
- Muscular Dystrophy Family Foundation
- Myotubular Myopathy Resource Group
- Myotubular Trust
- NORD - Becker Muscular Dystrophy
- NORD - Congenital Muscular Dystrophy
- NORD - Distal Myopathy
- NORD - Duchenne Muscular Dystrophy
- NORD - Emery-Dreifuss Muscular Dystrophy
- NORD - Fukuyama Congenital Muscular Dystrophy
- NORD - Limb-Girdle Muscular Dystrophy
- NORD - Nemaline Myopathy
- NORD - Walker-Warburg Syndrome
- NORD - X-linked Myotubular Myopathy