Comprehensive Muscular Dystrophy / Myopathy Panel

Updated
Summary
  • Is a 125 gene panel that includes assessment of non-coding variants.
  • In addition, it also includes the maternally inherited mitochondrial genome. Is ideal for patients with distal myopathy or a clinical suspicion of muscular dystrophy. Includes the smaller Nemaline Myopathy Panel, LGMD and Congenital Muscular Dystrophy Panel, Emery-Dreifuss Muscular Dystrophy Panel and Collagen Type VI-Related Disorders Panel.

Analysis methods
  • PLUS
Availability

4 weeks

Number of genes

125

Test code

NE0701

Panel size

Large

CPT code *
81443(1)
* The CPT codes provided are based on AMA guidelines and are for informational purposes only. CPT coding is the sole responsibility of the billing party. Please direct any questions regarding coding to the payer being billed.

Summary

The Blueprint Genetics Comprehensive Muscular Dystrophy / Myopathy Panel (test code NE0701):

ICD codes

Commonly used ICD-10 code(s) when ordering the Comprehensive Muscular Dystrophy / Myopathy Panel

ICD-10 Disease
F84.2 Rett syndrome
G71.0 Muscular dystrophy
G71.0 Emery-Dreifuss muscular dystrophy
G71.0 Limb-girdle muscular dystrophy
G71.2 Congenital muscular dystrophy
G71.2 Nemaline myopathy
H49.40 Progressive external ophthalmoplegia
G11.9 Hereditary ataxia
C94.2 Acute Megakaryoblastic Leukemia
K59.8 Chronic Intestinal Pseudoobstruction
T36.5 Adverse effect of aminoglycosides
G93.41 Metabolic Encephalopathy
H49.81 Kearns Sayre Syndrome
E88.42 MERFF Syndrome
H47.013 Nonarteritic Anterior Ischemic Optic Neuropathy
G60.2 Neuropathy in association with hereditary ataxia
G30 Alzheimer's Disease
G25.5 Chorea
G40 Epilepsy and recurrent seizures
I42 Cardiomyopathy
N26.9 Focal Segmental Glomerulosclerosis
G31.82 Leigh's Disease
H47.2 Leber's hereditary optic neuropathy
G71.3 Mitochondrial Myopathy
I42.1 Hypertrophic Cardiomyopathy
E11.9 Non-Insulin Dependent Diabetes Mellitus
Z86.74 Personal history of sudden cardiac arrest
H90.3 Sensorineural Hearing Loss

Sample Requirements

  • Blood (min. 1ml) in an EDTA tube
  • Extracted DNA, min. 2 μg in TE buffer or equivalent
  • Saliva (Please see Sample Requirements for accepted saliva kits)

Label the sample tube with your patient's name, date of birth and the date of sample collection.

We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.

Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.

Read more about our sample requirements here.

Muscular dystrophies and myopathies are a complex group of neuromuscular or musculoskeletal disorders that typically result in progressive muscle weakness. The age of onset, affected muscle groups and additional symptoms depend on the type of the disease.

Limb girdle muscular dystrophy (LGMD) is a group of disorders with atrophy and weakness of proximal limb girdle muscles, typically sparing the heart and bulbar muscles. However, cardiac and respiratory impairment may be observed in certain forms of LGMD. In congenital muscular dystrophy (CMD), the onset of muscle weakness typically presents in the newborn period or early infancy. Clinical severity, age of onset, and disease progression are highly variable among the different forms of LGMD/CMD. Phenotypes overlap both within CMD subtypes and among the congenital muscular dystrophies, congenital myopathies, and LGMDs. Emery-Dreifuss muscular dystrophy (EDMD) is a condition that affects mainly skeletal muscle and heart. Usually it presents in early childhood with contractures, which restrict the movement of certain joints – most often elbows, ankles, and neck. Most patients also experience slowly progressive muscle weakness and wasting, beginning with the upper arm and lower leg muscles and progressing to shoulders and hips. Almost all patients with EDMD have cardiac involvement by adulthood. It presents clinically as cardiac conduction defects and/or arrhythmias. The cardiomyopathy phenotype is usually classified as dilated cardiomyopathy (DCM) but also ARVC and hypertrophic cardiomyopathies (HCM) have been described. A small proportion of patients with autosomal dominant EDMD experience cardiac manifestation without any skeletal muscle weakness or wasting.

Dystrophinopathies include a spectrum of muscle diseases ranging from asymptomatic with an increase in serum concentration of creatine phosphokinase to the severe progressive muscle diseases that are classified as Duchenne or Becker muscular dystrophy (DMD or BMD) when skeletal muscle is primarily affected and as DMD-associated DCM when the heart is primarily affected. DMD usually presents in early childhood with delayed milestones, including delays in sitting and standing independently. DMD is rapidly progressive, with affected children being wheelchair dependent by age 13 years and cardiomyopathy occurring soon after that. BMD is characterized by later onset skeletal muscle weakness; some individuals remain ambulatory into their 20s. However, heart failure from DCM is a common cause of death in the mid-40s. DMD-associated DCM is characterized by left ventricular dilation and congestive heart failure. Females heterozygous for a pathogenic variant in DMD are at increased risk for DCM.

The collagen type VI-related disorders are now recognized to be a continuum of overlapping phenotypes with Bethlem myopathy at the mild end and Ullrich congenital muscular dystrophy (UCMD) at the severe end. In between these phenotypes, there are collagen type VI-related limb-girdle muscular dystrophy and myosclerosis myopathy. Bethlem myopathy is characterized by proximal weakness and variable contractures. Elbows, ankles and fingers are most often affected. If the onset is in early childhood, delayed motor milestones, muscle weakness and contractures are evident. Adult onset patients require eventually ambulatory support. UCMD is characterized by congenital muscle weakness, proximal joint contractures, and striking hyperlaxity of distal joints. Affected children rarely gain the ability to walk independently and spinal rigidity and scoliosis develop. Respiratory failure is a common cause of death in the first and second decade of life. Intelligence is normal in both Bethlem myopathy and UCMD.

Nemaline Myopathy is characterized by weakness, hypotonia, and depressed or absent deep tendon reflexes. Histopathologically, nemaline bodies are detected on muscle biopsy. The clinical classification defines six forms of Nemaline Myopathy, which are classified by onset and severity of motor and respiratory involvement. Considerable overlap occurs among the forms.

Genes in the Comprehensive Muscular Dystrophy / Myopathy Panel and their clinical significance

Gene Associated phenotypes Inheritance ClinVar HGMD
ACTA1 Myopathy AD/AR 68 212
ANO5 Gnathodiaphyseal dysplasia, LGMD2L and distal MMD3 muscular dystrophies AD/AR 64 121
ATP2A1 Brody myopathy AR 19 18
B3GALNT2# Muscular dystrophy-dystroglycanopathy AR 18 14
BAG3 Dilated cardiomyopathy (DCM), Myopathy, myofibrillar AD 39 62
BICD2 Childhood-onset proximal spinal muscular atrophy with contractures AD 12 28
BIN1 Myopathy, centronuclear AD/AR 9 15
CAPN3 Muscular dystrophy, limb-girdle, Eosinophilic myositis AR 184 437
CAV3 Creatine phosphokinase, elevated serum, Hypertrophic cardiomyopathy (HCM), Long QT syndrome, Muscular dystrophy, limb-girdle, type IC, Myopathy, distal, Tateyama type, Rippling muscle disease 2 AD/AR 23 50
CFL2 Nemaline myopathy AR 2 9
CHKB Muscular dystrophy, congenital, megaconial AR 11 27
CNTN1 Myopathy, congenital, Compton-North AR 5 2
COL12A1 Bethlem myopathy, Ullrich congenital muscular dystrophy AD/AR 14 13
COL4A1 Schizencephaly, Anterior segment dysgenesis with cerebral involvement, Retinal artery tortuosity, Porencephaly, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Brain small vessel disease AD 58 107
COL4A2 Hemorrhage, intracerebral AD 14 12
COL6A1 Bethlem myopathy, Ullrich congenital muscular dystrophy AD/AR 81 132
COL6A2 Epilepsy, progressive myoclonic, Bethlem myopathy, Myosclerosis, congenital, Ullrich congenital muscular dystrophy AD/AR 101 182
COL6A3 Bethlem myopathy, Dystonia, Ullrich congenital muscular dystrophy AD/AR 68 138
CRYAB Cataract, myofibrillar myopathy and cardiomyopathy, Congenital cataract and cardiomyopathy, Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Cataract 16, multiple types, Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related AD 14 28
DES Dilated cardiomyopathy (DCM), Myopathy, myofibrillar, Scapuloperoneal syndrome, neurogenic, Kaeser type AD/AR 64 124
DMD Becker muscular dystrophy, Duchenne muscular dystrophy, Dilated cardiomyopathy (DCM) XL 832 3915
DNAJB6 Muscular dystrophy, limb-girdle AD 11 17
DYSF Miyoshi muscular dystrophy, Muscular dystrophy, limb-girdle, Myopathy, distal, with anterior tibial onset AR 244 529
EMD Emery-Dreifuss muscular dystrophy XL 48 113
FDX1L Myopathy AR 1 2
FHL1* Myopathy with postural muscle atrophy, Emery-Dreifuss muscular dystrophy, Reducing bod myopathy XL 26 62
FKRP Muscular dystrophy-dystroglycanopathy AR 66 140
FKTN Muscular dystrophy-dystroglycanopathy, Dilated cardiomyopathy (DCM), Muscular dystrophy-dystroglycanopathy (limb-girdle) AD/AR 45 58
FLNC* Myopathy AD 54 109
GAA Glycogen storage disease AR 193 573
GMPPB Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), Limb-girdle muscular dystrophy-dystroglycanopathy AR 19 41
GOLGA2 Microcephaly, seizures, and developmental delay AR 2
INPP5K Muscular dystrophy, congenital, with cataracts and intellectual disability (MDCCAID) AR 8 10
ISPD Muscular dystrophy-dystroglycanopathy AR 38 53
ITGA7 Muscular dystrophy, congenital, due to integrin alpha-7 deficiency AR 16 8
KBTBD13 Nemaline myopathy AD 4 10
KLHL40 Nemaline myopathy AR 11 26
KLHL41 Nemaline myopathy AR 8 8
LAMA2 Muscular dystrophy, congenital merosin-deficient AR 199 301
LARGE Muscular dystrophy-dystroglycanopathy AR 19 27
LDB3 Dilated cardiomyopathy (DCM), Myopathy, myofibrillar AD 9 14
LIMS2 Muscular dystrophy, limb-girdle AR 2 3
LMNA Heart-hand syndrome, Slovenian, Limb-girdle muscular dystrophy, Muscular dystrophy, congenital, LMNA-related, Lipodystrophy (Dunnigan), Emery-Dreiffus muscular dystrophy, Malouf syndrome, Dilated cardiomyopathy (DCM), Mandibuloacral dysplasia type A, Progeria Hutchinson-Gilford type AD/AR 250 564
LMOD3 Severe congenital nemaline myopathy, Typical nemaline myopathy AR 8 15
MAP3K20 Centronuclear myopathy AR 5 7
MEGF10 Myopathy, early-onset, areflexia, respiratory distress, and dysphagia AR 20 19
MICU1 Myopathy with extrapyramidal signs AR 10 8
MME Spinocerebellar ataxia 43, Charcot-Marie-Tooth disease, axonal, type 2T AD/AR 14 21
MT-ATP6 Neuropathy, ataxia, and retinitis pigmentosa, Leber hereditary optic neuropathy, Ataxia and polyneuropathy, adult-onset, Cardiomyopathy, infantile hypertrophic, Leigh syndrome, Striatonigral degeneration, infantile, mitochondrial Mitochondrial 19
MT-ATP8 Cardiomyopathy, apical hypertrophic, and neuropathy, Cardiomyopathy, infantile hypertrophic Mitochondrial 4
MT-CO1 Myoglobinuria, recurrent, Leber hereditary optic neuropathy, Sideroblastic anemia, Cytochrome C oxidase deficiency Mitochondrial 17
MT-CO2 Cytochrome c oxidase deficiency Mitochondrial 8
MT-CO3 Cytochrome c oxidase deficiency, Leber hereditary optic neuropathy Mitochondrial 9
MT-CYB Leber hereditary optic neuropathy Mitochondrial 69
MT-ND1 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia Mitochondrial 21
MT-ND2 Leber hereditary optic neuropathy, Mitochondrial complex I deficiency Mitochondrial 6
MT-ND3 Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 7
MT-ND4 Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 11
MT-ND4L Leber hereditary optic neuropathy Mitochondrial 2
MT-ND5 Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Leber hereditary optic neuropathy, Mitochondrial complex I deficiency Mitochondrial 19
MT-ND6 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Oncocytoma, Leber hereditary optic neuropathy, Leber optic atrophy and dystonia, Mitochondrial complex I deficiency Mitochondrial 16
MT-RNR1 Deafness, mitochondrial Mitochondrial 3
MT-RNR2 Chloramphenicol toxicity/resistance Mitochondrial 2
MT-TA Leber hereditary optic neuropathy, Mitochondrial multisystemic disorder, Progressive external ophthalmoplegia, Dilated cardiomyopathy (DCM) Mitochondrial 4
MT-TC Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 3
MT-TD Mitochondrial multisystemic disorder Mitochondrial 1
MT-TE Diabetes-deafness syndrome, Mitochondrial myopathy, infantile, transient, Mitochondrial myopathy with diabetes Mitochondrial 5
MT-TF Myoclonic epilepsy with ragged red fibers, Nephropathy, tubulointerstitial, Encephalopathy, mitochondrial, Epilepsy, mitochondrial, Myopathy, mitochondrial, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes Mitochondrial 7
MT-TG Hypertrophic cardiomyopathy, Encephalopathy, Myopathy Mitochondrial 3
MT-TH Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes Mitochondrial 4
MT-TI Progressive external ophthalmoplegia Mitochondrial 7
MT-TK Myoclonic epilepsy with ragged red fibers Mitochondrial 5
MT-TL1 Cytochrome c oxidase deficiency, Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Diabetes-deafness syndrome, Cyclic vomiting syndrome, SIDS, susceptibility to Mitochondrial 14
MT-TL2 Progressive external ophthalmoplegia, Mitochondrial multisystemic disorder Mitochondrial 5
MT-TM Mitochondrial Myopathy, Leigh syndrome, Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes Mitochondrial 1
MT-TN Progressive external ophthalmoplegia Mitochondrial 3
MT-TP Mitochondrial multisystemic disorder Mitochondrial 2
MT-TQ Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes, Encephalopathy Mitochondrial 2
MT-TR Dilated cardiomyopathy (DCM) Mitochondrial 2
MT-TS1 Myoclonic epilepsy with ragged red fibers, Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 10
MT-TS2 Mitochondrial multisystemic disorder Mitochondrial 2
MT-TT Mitochondrial 5
MT-TV Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes Mitochondrial 3
MT-TW Leigh syndrome, Mitochondrial Myopathy Mitochondrial 8
MT-TY Mitochondrial 4
MTM1 Myopathy, centronuclear XL 158 301
MYH7 Hypertrophic cardiomyopathy (HCM), Myopathy, myosin storage, Myopathy, distal, Dilated cardiomyopathy (DCM) AD 305 986
MYO18B Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism AR 2 4
MYOT Myopathy, myofibrillar, Muscular dystrophy, limb-girdle, 1A, Myopathy, spheroid body AD 6 16
NEB#* Nemaline myopathy AR 305 309
PABPN1 Oculopharyngeal muscular dystrophy AD/AR 6 23
PNPLA2 Neutral lipid storage disease with myopathy AR 13 35
POGLUT1 Dowling-Degos disease 4, Muscular dystrophy, limb-girdle, type 2Z AD 6 13
POLG POLG-related ataxia neuropathy spectrum disorders, Sensory ataxia, dysarthria, and ophthalmoparesis, Alpers syndrome, Progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial DNA depletion syndrome AD/AR 89 290
POMGNT1 Muscular dystrophy-dystroglycanopathy AR 96 88
POMGNT2 Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 8 AR 6 9
POMK Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A, 12, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type C, 12, Muscle-eye brain disease, Walker-Warburg syndrome AR 6 8
POMT1 Muscular dystrophy-dystroglycanopathy AR 47 96
POMT2 Muscular dystrophy-dystroglycanopathy AR 45 73
PYROXD1* Myopathy, myofibrillar 8 AR 5 6
RBCK1 Polyglucosan body myopathy AR 11 14
RYR1 Central core disease, Malignant hyperthermia, Minicore myopathy with external ophthalmoplegia, Centronuclear myopathy, Minicore myopathy, Multicore myopathy AD/AR 241 666
SELENON# Muscular dystrophy, rigid spine, Myopathy, congenital, with fiber- disproportion AR 38 63
SEPT9 Amyotrophy, hereditary neuralgic AD 4 11
SGCA Muscular dystrophy, limb-girdle AR 60 100
SGCB Muscular dystrophy, limb-girdle AR 37 64
SGCD Muscular dystrophy, limb-girdle, Dilated cardiomyopathy (DCM) AR 21 27
SGCG Muscular dystrophy, limb-girdle AR 33 63
SMCHD1 Facioscapulohumeral muscular dystrophy, Facioscapulohumeral muscular dystrophy, type 2 AD 51 79
SPEG Centronuclear myopathy 5 AR 5 11
SPTBN4 Myopathy, congenital, with neuropathy and deafness AR 6 7
SYNE1 Spinocerebellar ataxia, autosomal recessive 8 AD/AR 83 136
TCAP Muscular dystrophy, limb-girdle, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy (DCM) AD/AR 12 28
TMEM126B Mitochondrial complex I deficiency AR 4 4
TMEM43 Arrhythmogenic right ventricular dysplasia, Emery-Dreifuss muscular dystrophy AD 4 24
TNNT1 Nemaline myopathy AR 6 8
TNPO3 Muscular dystrophy, limb-girdle AD 3 5
TOR1AIP1 Muscular dystrophy with progressive weakness, distal contractures and rigid spine AD/AR 3 5
TPM2 CAP myopathy, Nemaline myopathy, Arthrogryposis, distal AD 18 38
TPM3* CAP myopathy, Nemaline myopathy, Myopathy, congenital, with fiber- disproportion AD 21 27
TRAPPC11 Limb-girdle muscular dystrophy AR 13 17
TRIM32 Bardet-Biedl syndrome, Muscular dystrophy, limb-girdle AR 13 16
TTN* Dilated cardiomyopathy (DCM), Tibial muscular dystrophy, Limb-girdle muscular dystrophy, Hereditary myopathy with early respiratory failure, Myopathy, early-onset, with fatal cardiomyopathy (Salih myopathy), Muscular dystrophy, limb-girdle, type 2J AD 818 327
VMA21 Myopathy, X-linked, with excessive autophagy XL 9 11
VPS13A Choreoacanthocytosis AR 19 115

* Some, or all, of the gene is duplicated in the genome. Read more.

# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.

The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#)

Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.

Non-coding variants covered by Comprehensive Muscular Dystrophy / Myopathy Panel

Gene Genomic location HG19 HGVS RefSeq RS-number
CAPN3 Chr15:42678352 c.380-13T>A NM_000070.2
CAPN3 Chr15:42695919 c.1746-20C>T NM_000070.2
CAPN3 Chr15:42697047 c.-188G>C NM_173089.1
CAPN3 Chr15:42702715 c.2184+21G>A NM_000070.2 rs763572829
CAPN3 Chr15:42702770 c.2185-16A>G NM_000070.2
COL4A1 Chr13:110802675 c.*35C>A NM_001845.4
COL4A1 Chr13:110802678 c.*32G>A/T NM_001845.4
COL4A1 Chr13:110802679 c.*31G>T NM_001845.4
COL6A1 Chr21:47409500 c.859-22A>G NM_001848.2 rs398123642
COL6A1 Chr21:47409627 c.904-39A>G NM_001848.2
COL6A1 Chr21:47409881 c.930+189C>T NM_001848.2
COL6A1 Chr21:47413935 c.1336-146C>T NM_001848.2
COL6A2 Chr21:47538492 c.1117-35_1118dupAAAAGACGTGAGGCTGATTCTGCAAACCCTTCCAGGG NM_001849.3
COL6A2 Chr21:47541407 c.1459-63G>A NM_001849.3
COL6A3 Chr2:238268046 c.6283-15C>A NM_004369.3
DMD ChrX:31165653 c.10554-18C>G NM_004006.2
DMD ChrX:31200680 c.9974+175T>A NM_004006.2
DMD ChrX:31224814 c.9564-30A>T NM_004006.2
DMD ChrX:31225211 c.9564-427T>G NM_004006.2
DMD ChrX:31226400 c.9563+1215A>G NM_004006.2
DMD ChrX:31229031 c.9362-1215A>G NM_004006.2
DMD ChrX:31241047 c.9361+117A>G NM_004006.2
DMD ChrX:31279293 c.9225-160A>G NM_004006.2
DMD ChrX:31279418 c.9225-285A>G NM_004006.2
DMD ChrX:31279420 c.9225-287C>A NM_004006.2
DMD ChrX:31279780 c.9225-647A>G NM_004006.2 rs398124091
DMD ChrX:31279781 c.9225-648A>G NM_004006.2 rs398124084
DMD ChrX:31332523 c.9224+9192C>A NM_004006.2
DMD ChrX:31382270 c.9085-15519G>T NM_004006.2
DMD ChrX:31613687 c.8217+32103G>T NM_004006.2
DMD ChrX:31627738 c.8217+18052A>G NM_004006.2
DMD ChrX:31697714 c.7661-11T>C NM_004006.2
DMD ChrX:31897527 c.6913-4037T>G NM_004006.2
DMD ChrX:31983146 c.6614+3310G>T NM_004006.2 rs797045526
DMD ChrX:32274692 c.6290+30954C>T NM_004006.2
DMD ChrX:32305833 c.6118-15A>G NM_004006.2
DMD ChrX:32360414 c.5740-15G>T NM_004006.2
DMD ChrX:32366860 c.5326-215T>G NM_004006.2
DMD ChrX:32379144 c.5325+1743_5325+1760delTATTAAAAAATGGGTAGA NM_004006.2
DMD ChrX:32398808 c.4675-11A>G NM_004006.2
DMD ChrX:32460274 c.3787-843C>A NM_004006.2
DMD ChrX:32470726 c.3603+2053G>C NM_004006.2
DMD ChrX:32479316 c.3432+2240A>G NM_004006.2
DMD ChrX:32479520 c.3432+2036A>G NM_004006.2
DMD ChrX:32669100 c.961-5831C>T NM_004006.2 rs398124099
DMD ChrX:32669194 c.961-5925A>C NM_004006.2
DMD ChrX:32716130 c.832-15A>G NM_004006.2 rs72470513
DMD ChrX:32756908 c.650-39498A>G NM_004006.2
DMD ChrX:32827744 c.531-16T>A/G NM_004006.2
DMD ChrX:32827744 c.531-16T>A NM_004006.2
DMD ChrX:32827744 c.531-16T>G NM_004006.2
DMD ChrX:32841967 c.265-463A>G NM_004006.2
DMD ChrX:33032666 c.93+5590T>A NM_004006.2
DMD ChrX:33192452 c.31+36947G>A NM_004006.2
DMD ChrX:33229483 c.-54T>A NM_004006.2
DYSF Chr2:71817308 c.3443-33A>G NM_003494.3 rs786205083
DYSF Chr2:71840553 c.4410+13T>G NM_003494.3
DYSF Chr2:71889030 c.4886+1249G>T NM_003494.3
DYSF Chr2:71900503 c.5668-824C>T NM_003494.3
DYSF Chr2:71913729 c.*107T>A NM_003494.3 rs11903223
EMD ChrX:153608559 c.266-27_266-10delTCTGCTACCGCTGCCCCC NM_000117.2
FKRP Chr19:47249328 c.-272G>A NM_024301.4
FKTN Chr9:108368857 c.648-1243G>T NM_006731.2
GAA Chr17:78078341 c.-32-13T>A NM_000152.3
GAA Chr17:78078341 c.-32-13T>G NM_000152.3 rs386834236
GAA Chr17:78078351 c.-32-3C>A/G NM_000152.3
GAA Chr17:78078352 c.-32-2A>G NM_000152.3
GAA Chr17:78078353 c.-32-1G>C NM_000152.3
GAA Chr17:78078369 c.-17C>T NM_000152.3
GAA Chr17:78082266 c.1076-22T>G NM_000152.3 rs762260678
GAA Chr17:78090422 c.2190-345A>G NM_000152.3
GAA Chr17:78092432 c.2647-20T>G NM_000152.3
GMPPB Chr3:49761246 c.-87C>T NM_013334.3 rs780961444
LAMA2 Chr6:129633984 c.3175-22G>A NM_000426.3 rs777129293
LAMA2 Chr6:129636608 c.3556-13T>A NM_000426.3 rs775278003
LAMA2 Chr6:129714172 c.5235-18G>A NM_000426.3 rs188365084
LAMA2 Chr6:129835506 c.8989-12C>G NM_000426.3 rs144860334
LMNA Chr1:156100609 c.513+45T>G NM_170707.3
LMNA Chr1:156105681 c.937-11C>G NM_170707.3 rs267607645
LMNA Chr1:156107037 c.1608+14G>A NM_170707.3
LMNA Chr1:156107433 c.1609-12T>G NM_170707.3 rs267607582
MTM1 ChrX:149767035 c.137-19_137-16delACTT NM_000252.2
MTM1 ChrX:149767045 c.137-11T>A NM_000252.2
MTM1 ChrX:149783032 c.232-26_232-23delGACT NM_000252.2
MTM1 ChrX:149808833 c.529-909A>G NM_000252.2
MTM1 ChrX:149818176 c.868-13T>A NM_000252.2
NEB Chr2:152355017 c.24220-151C>A NM_001271208.1
NEB Chr2:152410918 c.19429-381_19429-379delTTTinsA NM_001271208.1
POMT1 Chr9:134379574 c.-30-2A>G NM_007171.3
POMT2 Chr14:77751989 c.1333-14G>A NM_013382.5
RYR1 Chr19:38997317 c.8692+131G>A NM_000540.2
RYR1 Chr19:39074134 c.14647-1449A>G NM_000540.2 rs193922886
SELENON Chr1:26143316 c.*1107T>C NM_020451.2
SEPT9 Chr17:75316275 c.-134G>C NM_006640.4 rs80338760
SGCA Chr17:48246419 c.585-31_585-23delTCTGCTGAC NM_000023.2
SGCA Chr17:48246421 c.585-31_585-24delTCTGCTGA NM_000023.2
SGCA Chr17:48247492 c.748-12_748-11delCTinsAA NM_000023.2
SGCG Chr13:23755086 c.-127_-121delACAGTTG NM_000231.2 rs1422849467
SGCG Chr13:23755215 c.-1+1G>T NM_000231.2
SMCHD1 Chr18:2701019 c.1647+103A>G NM_015295.2
SMCHD1 Chr18:2705677 c.1843-15A>G NM_015295.2
SMCHD1 Chr18:2743740 c.3634-19A>G NM_015295.2
SYNE1 Chr6:152640163 c.16237-13C>G NM_182961.3
SYNE1 Chr6:152643033 c.15918-12A>G NM_182961.3 rs606231134
VMA21 ChrX:150572076 c.54-27A>C/T NM_001017980.3
VMA21 ChrX:150572076 c.54-27A>C NM_001017980.3 rs878854352
VMA21 ChrX:150572076 c.54-27A>T NM_001017980.3
VMA21 ChrX:150572082 c.54-16_54-8delGTTTACTTT NM_001017980.3 rs878854357

Added and removed genes from the panel

Genes added Genes removed
MT-ATP6
MT-ATP8
MT-CO1
MT-CO2
MT-CO3
MT-CYB
MT-ND1
MT-ND2
MT-ND3
MT-ND4
MT-ND4L
MT-ND5
MT-ND6
MT-RNR1
MT-RNR2
MT-TA
MT-TC
MT-TD
MT-TE
MT-TF
MT-TG
MT-TH
MT-TI
MT-TK
MT-TL1
MT-TL2
MT-TM
MT-TN
MT-TP
MT-TQ
MT-TR
MT-TS1
MT-TS2
MT-TT
MT-TV
MT-TW
MT-TY

Test Strengths

The strengths of this test include:
  • CAP accredited laboratory
  • CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory
  • Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance
  • Careful construction of clinically effective and scientifically justified gene panels
  • Some of the panels include the whole mitochondrial genome (please see the Panel Content section)
  • Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level
  • Our publicly available analytic validation demonstrating complete details of test performance
  • ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section)
  • Our rigorous variant classification scheme
  • Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data
  • Our comprehensive clinical statements

Test Limitations

The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: B3GALNT2 (NM_001277155:2), SELENON (NM_020451:3). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).

This test does not detect the following:
  • Complex inversions
  • Gene conversions
  • Balanced translocations
  • Some of the panels include the whole mitochondrial genome but not all (please see the Panel Content section)
  • Repeat expansion disorders unless specifically mentioned
  • Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
  • Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability)
  • Stretches of mononucleotide repeats
  • Low level heteroplasmy in mtDNA (>90% are detected at 5% level)
  • Indels larger than 50bp
  • Single exon deletions or duplications
  • Variants within pseudogene regions/duplicated segments
  • Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.

The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.

For additional information, please refer to the Test performance section and see our Analytic Validation.

The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.

Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).

Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.

Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.

Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 96.9% (7,563/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (37/37)
     
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
     
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%


Performance of Blueprint Genetics Mitochondrial Sequencing Assay.

Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X

Bioinformatics

The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding and regulatory variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. If the test includes the mitochondrial genome the target region gene list contains the mitochondrial genes. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases including, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to make the process effective and efficient. For missense variants, in silico variant prediction tools such as  SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, ordering providers have access to the details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with suboptimal coverage (<20X for nuclear genes and <1000X for mtDNA) if applicable. This reflects our mission to build fully transparent diagnostics where ordering providers can easily visualize the crucial details of the analysis process.

Clinical interpretation

We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.

Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.

The final step in the analysis is orthogonal confirmation. Sequence and copy number variants classified as pathogenic, likely pathogenic and variants of uncertain significance (VUS) are confirmed using bi-directional Sanger sequencing by orthogonal methods such as qPCR/ddPCR when they do not meet our stringent NGS quality metrics for a true positive call.

Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references, abstracts and variant databases used to help ordering providers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.

Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification. We do not recommend using variants of uncertain significance (VUS) for family member risk stratification or patient management. Genetic counseling is recommended.

Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Our internal database and our understanding of variants and related phenotypes increases with every case analyzed. Our laboratory is therefore well-positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.

Subscribe to our newsletter

Subscribe